Description :
From Genome Similarity Track
Location :
Scaffold_29:19358- 23525
Sequence
4167 bases(100 bases per row)
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTAC
GGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTT
AAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTAAGGATG
AGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGAGCGAGGATCCGAGGACAGGAAGTCCCTGT
GAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCA
GATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGAACACCCTGCAGCGGCACT
TTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGGGACGAGGAGAT
GGAGTCAGTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGTCACAGCCGGG
GCAGGTGCATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACAT
GGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCAGGGCCAGCCAGGAACTG
GTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGCACGACAAT
ACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGG
ATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCTACGACTTCCCGACGCAGAC
GAGCTTGAAGAAGTACTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGGTCCGGCAAGTATCGCCAAAAGGCTCCAACGCCTA
CGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCGAGT
CTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGAT
CTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTAGTCTGTGAGAAGTGTGGCA
AGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGAT
CCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAG
CCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACA
TGAAGTGTCAGTTGCCAGGATCTCTAGTTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCCTCAACCCTGGATCTACAAAGAGGAGAGACACGT
GGTTACTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTG
GATCTGAGGATGTTGGGTCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGG
GGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTG
GATGGGAGTCGACTCCAAGATTGTGTTGGGATTGGAGAAGGCGTATACCGTACAAACGGGAGAACGCGAATTAAGATCACGCTGGCAGGTTGTTTGGTGT
ATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGT