Description :
From Genome Similarity Track
Location :
Scaffold_151:19352- 21197
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_151-abinit-gene-0.37Conserved gene of unknown function

Sequence
1845 bases(100 bases per row)
TACACGAAAAAAATATATCGATATTTGAAGTGAGAATGTGAGGATTTGCATTGGATAACTCAATGACTTTGGCTTTGCTGCTTTCCTGTGACGTGTGAGA
TCGTCATCGAGATGGCTACAATGATCTACTTGATAGCACGGACTTCTCTGTGTGAGTTACTCGGATGTGATCATGCTGCACTGCTTTGGCTTGGGCGGAG
GCCACCAATCGCGACGCTTTGCGCATGCGTTCGCTCTCGTGCGTTGCATCTTGGAGGACATGTTTTTGTAGTCTGAAGAGATAAGCGAACTATCGCCAGT
CACTCGCGCTCCCGTTCTACTCGCATTGATGCATTACTGTCTCCTGCAAAAGACGGTGCGTATAATTGCGATTTCAAGATGTGCATTCGCGGCCCTCGCA
GTTTGCTCTTTGTACCCTCCAGTCTCCGCTTCAGCTCGTGGAACTTGGTGCTGTTTGGGTGGCGATTCCTCTTTATCGTGTTCTGCTGCTCGGCCGCGTC
GTCTTTTTGGATGTTGAGCGCATGAAGCTGCTGGCGAAGCGTTTTAGCTGGTGGAGAGCTCTTTACTGTTGCTGCTGTCTTGAGAGAGTGATTGACGTGA
GTATGCGTCTCCGGTCCAATCTCCTCTTCTTCCTGCATCTTTGGCTTCTTCTTATCGTTTGCTGGTACCGCCAGCATGCGCGCCGTGGTTTCCACTTGGT
ACCCGAGTCGGTACTTCGCGAGCAGCTTCGAGCGGAACGCTTTGGCGCTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGGCGATTGCTG
GATGCCGCGAAGCCATCCTTTCTGTCGCTTGAACTCTCGGAACACAAGCCGCGTCGTGACTCCTCGCCATTGAGACTGGATCCGGCTCACGAGCACATAT
TCGCGGAGCAGCATGCGCTTCGTGAGCTCCAACACGTTGGTCTCGACTTTGATCAGCGTTGGCCGTCCGCCCGAACGGCGCACAAACTCGCGGTAGTTCC
AGAAGAAGATGTTGCGCTCAGCGGGGTTGTCGTACCAGAACACGGGCGGCTGATCTGGCCGCGCCGTGAGCGCGTATGTCCAGNNNNNNNNNNNNNNNNN
NNNATGGACGGGTGCATGCGCTTGATCACGCACAGACAGCGCTCGATCAGCGTGCGCCTTCGCGCCTGCATGCCGCGCACGTAGGTCTGGATCTGCGTCG
CCGTGTGGTTGATCTTGCGCAAGTACCGCTCGCGCTCCACTTTGCGGCGTCGGTACTCTAGGCGCCCGAGAAAGCCACGTGCAATGCGCTGGATCAGCGC
CGTCGCGGGNNNNNNNNNNNNNNNNNNNNTGATCGCGATTCGCTCGTCCTCGATCTTCTCCTGGAAGCTCACGACGCCTGCGCGCATGTACTTGGAGCTC
CCGCAGCCCGCGCAGATTGGGAGCTGCTCGTACGCAGTATTCTCGGCATGTTGTTCTGCTTGTGGGTGGCTTTGGTTCTTCGATCGGACACGCAGGAGGT
TGACAAACGTGATGGTGTTGCATCGCGAGCACGTCAGGTACGGCGTCGACGCGACTGGGAGCGCACCAAGAACAGCAGCAGCTTCCAGAGATAGCGCTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCTTGTTGGGGGTCGCATGATGATGGTGCTTCTTCATACTGAGATGAGATTGCGGCTT
GGTCATGGCGCTTGGTGTCTTCCATGAGAGAAGTGAGAAGAGCGT