Description :
From Genome Similarity Track
Location :
Scaffold_23:1935- 7166
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-fgenesh-gene-0.13Formyl-coenzyme A transferase
Pytap_DAOMBR444maker-pag1_scaffold_23-fgenesh-gene-0.14GI13935
Pytap_DAOMBR444maker-pag1_scaffold_23-fgenesh-gene-0.0Nucleoredoxin

Sequence
5231 bases(100 bases per row)
CGTTGAACGAGCACTGTGTCAAATGCGCCAGTGGGATGGCACCAGGCGAGTGGCCaCGGGATCTGTCGGCTGGAGCAACTAGACCCCGAGACTTTCTGCT
GGACATGAGATGTGGGgCTTCGAACTCATGATCGAGACGAGCGTGGCATGCTCCTCCACCGTGTGTGCCTCCTGGCTCCTTtCGGgTgATTGCTCGTCGT
CCCACGCCCAAAGCACGTGAAATCAAGTCCCTCAATGGCAAACGACTTCACGAGGCTGCTGATAGAGAATCGCTTACATGTTGTCTATGGGTTGGTTGGT
GCATTATCTGTGGCTGTGTATGTAGGGCCAACAGCATCTGAGTACAGTGTGAATGATAGCTGCCGCATCGATCCAACTCAGATCGTGTGGCTGCCTCGTC
GACCTACACTGTAGGTCCTACAGTATGCACGCTGCTCTTGTACACTGCGGTTTAGCACATCTTCTCGGTTCTTGGTGATGAATCATCACTTCTCGATCAG
CCCTTTCGTCCCTCAAGGTCCATCCGTTGACTGCTTCGCGTTCAGCCGTCAGGGAGAGGGGTCACATTCCACACGGGCGCTGGCCAAAATCTCTTTCTTC
CTGAGCTCAGAAGAAGCGATGGTCTTGTCCAACCAGTTCAACACGAGAGCTGCTTGGGCACTGCTTGCTCACGTTGGATCCCCCGTCCATGGGCATGGGT
TTGCATCGCCCATCCTCTGGCGACAGCAGTCAAGCTATGGATACGCGAGTGCCACTGCAGTCGAGTTGGCTCGGCTCTCACCCGCAGTCCGACTCCCACT
GAGAATGGAATGCCGCAGGAGCATCCGGGGTTTCGTCCGAGAATCGAAGAGAGTGAAGTCGAGGCGGCCAAACTCACTCCGATCACACACTCGAACACGG
GATCAGGTCTTCGTCGACGTGGACGAGCATATGAATGCGTCTGCAATTGTTCGCCTACAGAACTCGCCTGAGCCAGAGCTGCGTGAACGAGTACGAAACC
ACCACTGGATTAAGCACGCGTCTCGTCCTCCTCTCtGAATCAACGTTTGACACGCCAATCCGGATGACTAGTTTGCATAGTAGACAGAACCAGAGTTGGC
GTAGCATCTATATTCTAGATCGTACCTGACGATTGCTAACGCCTAACTAGTTGGTTCGAATACAACCTCCTTCTGGAGAAGCTGTGCGATCTGCTCGTCC
GAACGGTGCAGGATACCCTGAAGCACGGCACGAGTATCTTCACCGATCTTACGTCCAGGCCATGTCGTCTGACCAGGGGTTCCCTGGAGCTTTGGAAGAA
TCGCTGGAaTCTTCACTGTTTGTTtGTGCCCACCGGCATCTCCGATGTTCACGTCTTCGAACATCTCGCGATGGATAAATTGTGGATCCTTGAACATATC
TTCAACTGAGTAAACAAGGCCAACAGGAATCCCTGCTTTCTCCATCGCGTCCATAACCCCAGTGGTCGTTCTCTCAGCAACCCAAGCAGCGATGGCGTTG
TCAATGTCTGCTTGATACTTCACACGATCTGGGTTGGTCTTGAACTTTGGATCCACAGCCATATCGTCACGACcAATCGCCTTCATGAAGAGCTCAAAGA
GCTTATCAGTGTTGGCGGCGATCACGACATTCTTCCCGTCGCTGCCCACATAAGTATTCGAAGGCACGATACCAGTGATTGTCGATCCCGAGCACTCACG
AATTGCCCCAGCATAATCATATTCGGGCACGACGGATTCCaTAAGGTTGTACATACTCTCATAGATTGCAACATCGACGACTTGACCCAGTTTCTCCTTG
GCCCGTTCACGGCCCAAAAGAGCGATTGTAATGCCAAGCGCAGCGTGGATACCTGTGATCGTGTCTCCAAGACTGAGGTTCTGACGCACTGGTGGGCGGT
CTGGgAACCCGTTCACATAGCGAAAGCCACCCATCGCTTCGCACACAGATGCAAATCCTGGTCTACGCCATTGACACATTATCAGTCAGTCAAAATCCTT
GAAATCCCTCAGCGAGAGGTCTGCTCACCGACTCGAGTATGGACCGTCTTGGCCGTAACCCGAGATGCGCGTGTACACGAGTCCTGGGTTCGCTTTCTCA
AACGTTTCTGGTCCAAGACCCCACTTCTCCATTCGACCAGGCTTGAAGTTCTCGATCAGCACGTCGCTAGAGTTGACGAGTTCGCGCAGCAGCTCACGAC
CTTCAGGCTTgCGGATATCCATGGCCACAGACTTCTTGTTGCGGCCAATCGAGTACCACCAAAGAGACATCTTGCTAGCATCAAGCTCACGCCATCCACG
GAGCTGGTcACCCGTTGGtGGTTCGATCTTGATCACCTCCGCGCCGAAGTAAGCGAGGATTGTGGCGGCGAACGGACCAGCGACAAGGTGACCGCACTCG
ATCACACGCACGCCCTCGAGCGGACGCGGGCGAGGCTTGGTACTCGCACTGGTAGAGACATCGCTTCCATACTGCAGAGTGGTGACGCTGCGCGTGTGGG
CTGAGAGCGCATGGCGGCGCATGAGGCGCACGGCGGGCAGCATGATGGGGGgCAGTGCACTTGGGTTATGGgCGGGgTGGGgCGGAGTGACGTTGTGTTG
GTAGGGgTAGGGGTGACAGGCTTCAACGACAAACTGATTGGCCAAACACAACTTCAACCTGTAAGAATGAGTATCAAGgATACAAGGCATTAGGCTAGGT
TGCGGGTGAGAAGCCAATTAGCTATGTTGTGGGTGGAAGACTAATTAGTTTCCGTAAGACTGGGTGGgAACGGgTGGGCTGCATGCAACATGATAGTAGC
TGAAGGTCCCATGCATATCAGAGGAAGGCGTAAATATGCGCATGAGAGGAGCTGAGTTAGCGAACAATTCACAAAATGTAAAAGTAGTGTGAGCTGAGGC
ATACCTGACGGTACCAGCATCAGTAAGGCACAaGAAAACTCGCAGCGCAGCGGGCGATGTCGTTGCAGTTTCCGATGAGCTTGAAGCCACAGCGCTGGCA
AGTGCATGCAAATCCAGCAGCCTACAGCACAAAGGACTTTGCATGAGCATGTCATTGATAAAGGACCACCTTGTATACCTTTTGATGGACATGGTAGGCT
CTTGAGTAGTGTCGACGACGATGAACGCGCATCGATGGCGCTCAGGATCCGAGTTGGCGTCGCCTTCCACGACAGACAGAGCAGGGCTCTTGGTCTTCCt
CTTTTTCTCTAATCGGTTGTCCTGGAGTCGGTCGAGACATGCTTCTCCAGTAATGACTGGAGGGTCCGAGTTCTGTGATGACGACGAATGGCTGGCATGC
CATCGGATGAGTCCACGTTCCTCAAGTAGGTCTGTGAGGACCTGCGCATCACGCAGAAGAAAGGTGTGGCCTCATGTtAGTTTTtGGCATTCGACGAGCA
CTCCTCCGTTGATGTGTCACCGTTTGGGCTGGCAGTGGCAAACATTGTAGTGAGTCGCGGGTTAGCATGCCAATCTGCATGGACCGCGGAAAATTCAAAA
ATGAGGGCGAAAAGCATGGAGTTTGCAACTAAAAACGCTTTCCACTATATGTACACGACGCTACGCCTCTAGGCACAGAGTTCCTACGATACAATCGCGT
CTGGACGCACGCACATCCAGTAGTCGTTTTCCTTGAGCACGCTACCGATTGTGTTGCGGGTGCTTCGATGCACGTGGGAGCCCGATGGGTTCTTTTCAGC
CCGCCAGAACCAGCGAGTGACCAGCACTTCGTCCTCAAGCGTGTCTTCATCGTCAGTAGCTTCATTTTTGTTGTAGGATGTGACCAACAGCGGCGTACGG
ATCGTGTGGATAATCAGTCGAAGAGTTGGCAACCACTGGTCATAACCCCAGACGCCGGCATTGAAGCAAACAGCCAAGTCAGGCCGAAGATACCGGTCCT
TCTCAGTGTAGTAGTCGTCGAAGCTTCCGACGTAGTAGCTGAGTTCGATCTGAATCGCAAGTGCTGAAGTTGCACTCATCGGGCACGCATCGGTATCAAC
ATGGGTCGACTCGTGTGAGTTATAGTGCAAGCATTGTGCGACGTTGGGGCCAACAAGCACGAGTTGGAGCGTCGCATAGCGCTGGTCGTCAACAGCAAGA
TACTGAGAGAACTGCTCGAAAATACCGAGTGTCTCCTTTGCGGTGTTTCCCTCACGGTGGTCAGCCCCAATTAGGTGGATGGTCAGCGTTCGCTTCTCAG
CGTCGGGACTTGAACTGTTGAAAGCCTCGTCGTGCACACTCGTGATACATGAGCGAGGCGCATCCTCGGAGCTGCCCTGCAGACGCTTGAGGCACTCGAT
GAGCGTGTGTGCCCGCGTCGCGTGCCGGGCTCCACCATCCATTGTTGCCGTTCGCGATACGTGACAGCCAaGAAGCGCAACAAAATGGGTGAACAGCCCA
CCCACAGTTgCTGTCAAGCCAGCGACAATAGCAGCCCAGGGGCATCTCTTCCTAGTGGTACGAACTGATAGGGATACAAACGACAACAGGTTACGTTGAA
CTTCAATCTAACCACATGATCGTGCACACTATGCGCAGGGCTTATAGGGCCAGCGAAGCCAGAAAAAGCGATGTGCCAACAACAACGAGAAGCCTCGTTC
TTCGCCTCACGCCAGCGCTTGTTAGGCGATTCTtGCATTCCCGAACTGCACACCAAGCGCGCACACGACTCAAGACCACGCGATACCATGACGCTCTTGA
AAAAACTTCTCGGCTCCAAGCTCACTTCGCGCCGTGGCGACGCGCCGACTGACCAAGTGCTGGATGGCAAGACGACCGTCGGGCTCTACTTCACTGCTAG
TACATGCCGTCCGTGCCAGCTCTTCACCCCTGTGCTTGCGACAGTTTACCGCAACATGTCACTCAACATGTATAAGCATTTGTCCATGCGGGAAGACATG
GAGGTCGTACTGGTGTCGATGGACAAGGAAGAGTACGCCTTCCGTGATATGTTGCTGCAGACGCCCTTCTGGGCACTTCCGTTTACGCGGCGTGAGGCTG
CAAAAGACCTGTGGAAGCGGTATGAAGTGAAGAAAATTCCGACGCTCATTTTTGTGAACGAACATGGAGAGCAGATCGAGCGCAACGGTCGTCATCTTGT
CGAAGATCATTACATGGAGCTGACGAAGATCTGGGAAGAACTACAGCAGAAGCGAGCCATGGCGgAGGGGATGCCGTGAGCCTAATTTAGTCATGTATAT
TCTTtATTTTCGCGCAGTCTCTATAAGAAaT