Description :
From Genome Similarity Track
Location :
Scaffold_160:19348- 21521
Transcript NameFunction/comments
Albla_Nc14087450vacuolar protein sortingassociated protein 41 putat
Albla_Nc14087460conserved hypothetical protein
Albla_Nc14087470conserved hypothetical protein

Sequence
2173 bases(100 bases per row)
AGCACGAAGACGCGTGTGTCCTCTCAAAGGAAGTCGTACGGATGAGATTGACTTTCCATCGATTCCGATAATGTGCATTTCAGGAAGAGGAAATTCAGTC
TCCAAAGCATCCGATTGCTTTTCTCGTGAAGGTCGATAGCCCAAAATACATAGAGACTCATCATTCCACGCTGAAACACCGGCGATAAAGTAGTCAAGTG
CGATGATGGCAATTACTTTGCCTACGGATTTCGATCCATACGCTCCGTAATGCTTTCTCTGTCGATTGTCCACAGCTTTTGGATGGTGAGTGATTTCTGG
TTGCGATTGTGAGAGGTCCAATGAAACAATTTTAATTGTGTGAGCCCAAGCTACAATTAATTGCGTCTCTGAGAGCCAAATTAATTGGCAACGACTTAAT
TCCAATGGAGGACAGCGTTGTGGACGCTCTACAAAGGTAATTGGCTTCTCTTGCTCGACGTTGTACACTTTGACACCCCAATCGTTGGCCCATGCAACCA
ACTCCTGTTTCCATTGAATGCATTGAATTGGTCCTTCGCCTTCGTGAATGGTCAGTTCCTTGTCCAATATCCAGCCTTTGCGATTGATGGAGAATTGACC
GGTAAGGCCACCACACGCGAAAATGCGCTCACGACGAAAGGAATATTTTTCTTGGAATCTGACGCAATAAATTGCATTGTAATAATTGTAGATATTAATT
TCTCCAATATTTGATGATTTCGATGTAGGTTGGCTTGAAGTGGTGGAGAAAGAAGAAAAGAGGGTATAAATTGCTACGGTTCCATCGTCCGAGCATGAAG
CGATGTACTGGATTTTTTGAGTATGCATTAGAACAGTGTATCAATATTCACAGGAATAATTAATTACCTGTCCTGTCTCATCAATATGAAGGTCATTAAC
TTTCTTAGAATGGTGGTGTATGCGCTGTATGAAGGTTCCGTCCAGCTGTAGTAAGATCACATTCCCATTATACGTTCCAATGCAAATGTAATTAATGTGA
ACGGCGATGCAGGAGATTGCATCTTCTTTCAAGAGCGTCGGGAGGTAGCCGCCCAAACGTTCGTACTTGAGAATTGGCTCATGTGACGTGACGATTGTTT
TCTGTGATGGAAGTGCTTCCATCTCAAGAAAAGATTTAGATTCCATACAAATCCTGAACTATGTCATAGTATGAATTGGAAGAGGATATAAAAAACACAG
GTAACAAAAGAATGCTGATCAAAGTAAATTAGCAAGAGATATATATTCCTGCAGTAATCTTCTACGATCTTGATCCCATCACACTGGAAACAGCAAATTG
ACTCGCTTTATTGGCAAACGATGGATTCGAGCTCATAAAAGAAGCGGCTTCCTGTTGACCAGTTGTGTACCCCGTCGTCGGGTCTGCATTTGCGCTCATA
GTAGCCTTGAATTCTGGATGGCGACACATCACCAGCATATTGACAAATGCATTCATACACATCAAAATGCCTGCGAGGTACCCTAACGCTGAACTCATTC
CGAAATCCAGAAACCCAATAAAGAAAATAAAAGCCGCACGTCCTTTATACGTGTACAAAAACCCAAAATTCGCTCGAATCGGTGTTTCCATTCGTGAGAG
ACGACATTCAAAAAGGAGGAATAAGAATCCAAACATAATGACATAAATGGATACTAATGTCCCCGTGATATTAAGCGTGATAAAGGAAGTGATTCCCACG
AATCCAGCAATAATTTGTACGAGGGAACAGATCACATTGCCTAAACGCATGTATCGTAAGAGTTTGGGTAACTCCATTTTATTCACATCGTTGATTTTCT
GTAACACACTCTTCTTTGGCGCTTGTTCGGATTGCATCGTTCCGCTAACACTATCGATATTAACTGTTGTAGCGTTCATCATTGTCCTTCACTCTGAATC
GATCCGACAGAATCGAAGAAAAATATAAGTGTGACTCGTGGTCAATGTCTTTACCAAAATATAAATATAGCCAATATATAAATAAACCAGGTGATCAAGA
CAGCTATTTCTACCTCAACGATTATACACATTTACATGTGGATAGTGTATACCATTTATACTCTAATGTGTATACTTTGTAAATATCTTCTTTTGTATTT
TACCATCATGCATACGAATACTACACCATCACTCTGGCATCTACCACACGTATATCACGATTCCGCGTTCGGT