Description :
From Genome Similarity Track
Location :
Scaffold_80:19347- 21342
Transcript NameFunction/comments
Phyci_94980myosin-like protein

Sequence
1995 bases(100 bases per row)
GACGGCTGCGCCGACATGGTGAGCCTGAACTACCTGCACGAGCCGGCCATCCTGTTCAACCTGAAGCACCGCTTCCTGCGCCAAATCccctacacataca
cgggcgccatctgcatcgccgtgaaccccgtacgtggcCCCCATCTCCCCTCTATCGTCATCACCTGATATCTAACAAAAAGTGCTTTTTTAAAAAACGC
AGTACTCGTGGCTCGACATCTACACCAAGGAGCTGCAGGAGCAGTACCTGGAGCGCGACCGCAGCGAGCTGCCGCCCCACGTGTACGCCACGAGCGCCGG
CGCCTTCCAGCACATGCGCGTGTTCGGCGAGGACCAGAGCATCCTGGTGAGCGGCGAGTCGGGCGCCGGCAAGACGGAGACGACCAAGATCCTCATGTCC
CACTTGGCGTCGGCCGGCTCGCAGTCCACGTCGGACGCGCAGGCCAAGGAGGCCAGCATCATCGAGCGCGtgctggacgccaacccgctgatggagtcgt
tcggcaacgccaagacgtcgcgcaacgacaactcgagccgcttcggcaagttctcggagctgcagttcgacgcgctgggccagctcatcggcgcgcgctc
gcgcacgtacctgctggagaagtcgcgcgtgtcgctgcaaggcctgggcgagcgcaactaccacatcttctaccagctgctgGCGGCGCCCGAGGACGTG
ACCGCGGAGGTCAAGGTCACGGGCTTGCAGGCCAAGGACTTCCCCTTCATCAAGCCGCACGACGAGGACATCGCCAACGGCGTCGACGTCAGCGCCGGCT
TGAGGGACGCCGAGCGCTTCCAGCAGACCGTGTCGTGTCTCGAGACCATGGGCGTGTCCAAGGAGGACCAGATGAGCATCTTCAAGGTCGTGGCGGCCAT
TCTGCACCTGTCGCGTCTGCAGTTCGAACCCATGCCTGGCAATGACGATGCGTCGCAGCTGACGAACACGCCCGAGAACCAGCACGCGAGTGAGCTCGTG
TCGCAGCTAATGGAGTTCGACGACAACCAGCTGCACACGGCGCTTTGCACGCGCGAGATGACGGCGGTGATGGAGACGTACGAGGTGCCGCTGAACGTCT
CGCAGGCTGAGGGCGCGCGTACTGCTCTGGGCGTCGCGCTGTACTCGCACATGTTCTCGTGGCTCATCCACCGCGTCAACATGTCGACGAGCGCCCCGCA
CACGGATGTGGCTCACAAGATTTGCATCctggatatcttcggcttcgaaatcttcgagaagaactcgttcgagcagctgtgcatcaactacgccaacgag
aagctgcagcagaagttcacgcaggatgtgttcaagtccatccagcaggagtacgaggatgagggcatCCCCTGGACGCGCATTGAGTTCGCCGACAACG
TCAACGTCCTGTCCCTGCTCGAGGGTCGTTTCGGTGTGCTGTCGCTGCTGAACGAAGAGTGCATGCGCCCCAAGGGCAGCGACGCCGCTTTCGCCAACAA
GCTCAAGGCTCACTACAGCGACAACGACCGCTTCGAGTGCCCGCGTTTCGCCCGCGACGCGTTCGTGATCAAGCACTACGCCGGCCCCGTGCAGTACGAC
ACCACCGGTTTCCTGATCAAGAACACGGATGCGCTCCAGAACGACCTGATTCTGCTTATTAAGAAGTCGAAGGCACCTTTCCTCAAGAAGCTGTTCCCCG
AAGAGCACGTGGGTGATGCGATGACGGGTATTCCCGGCACGAGCGCTGCCGCTGCTGCCAATGCGGCGCGTGGTCGCCCTGGCCTCAAGCGGAAGAATTC
GATTGTCGCCGACACGGTGGGCACGCAGTTCAAGAGCCAGCTGAACGGTCTCATGGAGGACATTCGCCGCACGAACGTTCACTACATCCGCTGTATCAAG
CCTAACGGCAAGAAGAGTCCGCTGATCTTCAACAAACTGCGCGTGACGGAGCAGCTGCAGTGTGCCGGAGTTGTTGAGGCTGTGCGCATCAGTCG