Description :
From Genome Similarity Track
Location :
Scaffold_160:193437- 196174
Transcript NameFunction/comments
Aphin_H310_12320cell cycle-related kinase, putative
Aphin_H310_12321WD-repeat protein, putative

Sequence
2737 bases(100 bases per row)
GGCTCTGTCAGGAAGTACGGATGCTTCAGTGCCTGGATCAGCAAAGTGAGTTGTCGGACGTGGAAGGACGACACACCTCGGCGGCATCAAGACGTTGCGA
CGGATCATACACCAGCAAGTGCTTGAGTAAATCCAACGCAATGCTGTCGGTGTCTGCGAAGAGCGTCTCGAGCGGCAACGGGCTGAACACGGGAAACGAA
ACCTTGTGGTAGTCGGGCAAGTCGGCCATGCCAGGCCACGTCGGGGACCCAAGCACTTGCATCACGCGAAAGATCTGGTCGATGTCATTCATGCCTGGGA
ATAGCGGAGCATGTTGCAAGAGCTCCGCGAAGACAACTCCGACGGCCCACATGTCCACCTTGTGATTGTATGTTCGAGATCCGAACAAGAGCTCTGGAGA
TCGATACCATCTTGTCGCGACTTGATGAGCATATTCGCGTTCGGGTCCAGTGTACACCGTCGCAAGACCGAAATCACTAAGCTTCAGGACACCATGTTGG
TCCAAGAGCAGATTCGACGGCTTGATGTCCTGTTGCGAATGATGCAGGAGAGGTGCAGCTTCACGATGAAGGTAGGCTCGTACTCGATGGAGAATCTGTT
GGGTATGGCAGCACTCAACGCCGCGGAGAAGCATGTACATGAGAGATTTAGTGTCTTGCGCTGAAAAAGCAGCAGTCGAGTTCGCTATGAGCTATGTCAG
GGATGTATGAGCAGACAAAATACAGCTGACGCACGAACATGAGCTAGATCAGTTTCCATGTACTCGAGCACGAGGCCGACGCTCGCACCTTCAGGAATTA
CATCCACCAAGTGCACGACCTACATGCACAACTGGGCGTTGGTTCTCACGCCACGCCCGCTGTAGTTTACATTGGGGTGGTCGAGATGGTACATTGCTTG
GATCTCGTTGAAGGCCGCCGGAGGGATTGTCTCCATCTTGGAAGCGTCACTTCCAGTCCGGATGCGCTTCAGAGCGAAGACGTGCCCCGTGGCAATCTCT
CGGATTCGATAGACTTCTCCGAAGTTCCCGTGCCCCAGCCGCTCCAAGAGCTCGTACTTGTCGTCGAAGCGGCCGCCCGGCGGCCTATCCATCTCTCGAG
GATCTCTTGGGTTGTGCGACGGTGGGGTTCAACGCAACGTCGTTTCACGCATCTTCTACATATTTTTCTTGATTTTACTAGAGAATGGAGGGTGAGTTTT
TCAAATTTTGTTGAATTTTCAGAAAATGCATAAACGTGATCGGTTGAGTTTTTATCACATTTACTTGGTCAACATGGGAGTCGACGATGGCGATGCCGCG
GATGGCGCCGCGACGACAACGCACGTCCTGGACATCCAAAGCGACTGGCAAACAACAGCGGATGACTCCTTCTGGGTGAGCTCGTCAGATCGTGTCGTTC
TGTTGAACCCCGATCCGATTGCTGGCGCCGATGTCGTGCTCTATTCAGCCTCCCCGACCGTGATACATTCAGTGCACAAGACCAACCGAGGAATCGCATC
GTCACCGTACCACATTACCGGCCAGTCTCGCTATGGGTTAACGATTGCTTCGGAGTTGTACTCGACGACATTTTACACGCCCCATGCGCAGACGTCGATG
CAAACTCAGGTTCGCTAACAATCCCTCGTGCAGTCTCCAATCCATCGACTCAGCATGCGGGTAGTTGTACGCCGTGTCCACGAGCCCGAATGGCGCGTTT
GTCGGAGTCGGGGGTGCCGATGGTCTCTTCCACCTCACCCAAATCCCGACTCACACGAGCCTGCACCTTGCTGGTCATGTCGCGGACGTCACGCACGTCG
CGTTCTTTCCGAGTTCACTGGTGGCCCTCACCGGAAGTACCGACTTTTCGCTTCGTATATGGTCTCTCCAGTCGTTTAAGTGCGGCGCTGTACTGCGCGG
ACACCGCGGCGCCATTTGTGGCATTGGAATCCTCGGCCGCGGCCGCAACGTCGTGTGTACGTCCTGCCACTTGCTTGATGAGCCTTCCATTGACTGCTTG
CCCAGCGTGCGCGCACGATCGCTTGGTCAAGCTGTGGCACTGCGGAACGAGCTACAGCTTTCGCGATTGGGCGCTGTCGTCCACGCCGCGGTGCCTGAAC
GTCACTAGTGCGCTGCCACGAGAACCACACGATCTCGTTGAACCGTTGGGAATCGAGCCCAATAACATGGAATTCGAAACCAGTTCGACGTGGCTGGTGG
TAGGAACCGACGCGGGATGCACGGTCCTCGATGCGCGGGCGCCTACTCCTGTACGACCTGAGTGTTTCATCCATCCTAGGACTTCCCCTGACTGATATAG
GTCACACTTCTCCCGCATTCCGCGGCAGTGACGTCGTGCGCAACAAAGTCGCTAGATTCCGCGACTCTCTTGATCACCGGGACGGAGCACGGCGTGGTGT
CATCTTACGATATGCGATATGAAAAGTATGCTGGCCATGCTGCACCGATTCCAGGGCAACTGATTTCGTTTGTGTAGACGTCCTTTGTGCATGGTATCCC
GCAGCGGCGCGGACGTGCGATCGATTCAGTGGGCGGACAAGTCGATGGACGTGTGGGTGGCGACGGCCGACGGAAGCTGCACGAGATGGAGTGGCTTGGT
GTCCGATGGACGCTCACCACAAGTGACGGGGGAACTAGTTGGACCGACTTACGACGCAGTCAATGGCGTCAGCGTCTCGGTAGGAGGCACTCTCTCGACA
GTGTCCAGGGACGGCATCCTGCGATCGTACGATATCG