Description :
From Genome Similarity Track
Location :
Scaffold_80:19341- 21364
Transcript NameFunction/comments
Phyci_94980myosin-like protein

Sequence
2023 bases(100 bases per row)
AACCCGGACGGCTGCGCCGACATGGTGAGCCTGAACTACCTGCACGAGCCGGCCATCCTGTTCAACCTGAAGCACCGCTTCCTGCGCCAAATCccctaca
catacacgggcgccatctgcatcgccgtgaaccccgtacgtggcCCCCATCTCCCCTCTATCGTCATCACCTGATATCTAACAAAAAGTGCTTTTTTAAA
AAACGCAGTACTCGTGGCTCGACATCTACACCAAGGAGCTGCAGGAGCAGTACCTGGAGCGCGACCGCAGCGAGCTGCCGCCCCACGTGTACGCCACGAG
CGCCGGCGCCTTCCAGCACATGCGCGTGTTCGGCGAGGACCAGAGCATCCTGGTGAGCGGCGAGTCGGGCGCCGGCAAGACGGAGACGACCAAGATCCTC
ATGTCCCACTTGGCGTCGGCCGGCTCGCAGTCCACGTCGGACGCGCAGGCCAAGGAGGCCAGCATCATCGAGCGCGtgctggacgccaacccgctgatgg
agtcgttcggcaacgccaagacgtcgcgcaacgacaactcgagccgcttcggcaagttctcggagctgcagttcgacgcgctgggccagctcatcggcgc
gcgctcgcgcacgtacctgctggagaagtcgcgcgtgtcgctgcaaggcctgggcgagcgcaactaccacatcttctaccagctgctgGCGGCGCCCGAG
GACGTGACCGCGGAGGTCAAGGTCACGGGCTTGCAGGCCAAGGACTTCCCCTTCATCAAGCCGCACGACGAGGACATCGCCAACGGCGTCGACGTCAGCG
CCGGCTTGAGGGACGCCGAGCGCTTCCAGCAGACCGTGTCGTGTCTCGAGACCATGGGCGTGTCCAAGGAGGACCAGATGAGCATCTTCAAGGTCGTGGC
GGCCATTCTGCACCTGTCGCGTCTGCAGTTCGAACCCATGCCTGGCAATGACGATGCGTCGCAGCTGACGAACACGCCCGAGAACCAGCACGCGAGTGAG
CTCGTGTCGCAGCTAATGGAGTTCGACGACAACCAGCTGCACACGGCGCTTTGCACGCGCGAGATGACGGCGGTGATGGAGACGTACGAGGTGCCGCTGA
ACGTCTCGCAGGCTGAGGGCGCGCGTACTGCTCTGGGCGTCGCGCTGTACTCGCACATGTTCTCGTGGCTCATCCACCGCGTCAACATGTCGACGAGCGC
CCCGCACACGGATGTGGCTCACAAGATTTGCATCctggatatcttcggcttcgaaatcttcgagaagaactcgttcgagcagctgtgcatcaactacgcc
aacgagaagctgcagcagaagttcacgcaggatgtgttcaagtccatccagcaggagtacgaggatgagggcatCCCCTGGACGCGCATTGAGTTCGCCG
ACAACGTCAACGTCCTGTCCCTGCTCGAGGGTCGTTTCGGTGTGCTGTCGCTGCTGAACGAAGAGTGCATGCGCCCCAAGGGCAGCGACGCCGCTTTCGC
CAACAAGCTCAAGGCTCACTACAGCGACAACGACCGCTTCGAGTGCCCGCGTTTCGCCCGCGACGCGTTCGTGATCAAGCACTACGCCGGCCCCGTGCAG
TACGACACCACCGGTTTCCTGATCAAGAACACGGATGCGCTCCAGAACGACCTGATTCTGCTTATTAAGAAGTCGAAGGCACCTTTCCTCAAGAAGCTGT
TCCCCGAAGAGCACGTGGGTGATGCGATGACGGGTATTCCCGGCACGAGCGCTGCCGCTGCTGCCAATGCGGCGCGTGGTCGCCCTGGCCTCAAGCGGAA
GAATTCGATTGTCGCCGACACGGTGGGCACGCAGTTCAAGAGCCAGCTGAACGGTCTCATGGAGGACATTCGCCGCACGAACGTTCACTACATCCGCTGT
ATCAAGCCTAACGGCAAGAAGAGTCCGCTGATCTTCAACAAACTGCGCGTGACGGAGCAGCTGCAGTGTGCCGGAGTTGTTGAGGCTGTGCGCATCAGTC
GCATGGCGTACCCCAACCGTGTG