Description :
From Genome Similarity Track
Location :
scaffold_417:19338- 20404
Transcript NameFunction/comments
g8172.t1 pectate lyase

Sequence
1066 bases(100 bases per row)
AAGGTTCCGCTGTCCGTTAGTACGTTGAGCTCACAGTCGCGACTGAGACTCGACTCGCAGTCGCTCGCGGCCGTCGGTACGAAGAAGTTGCCGTCCTCGT
CGTCCAGATTGGGCGTCGTCACCGTCTCGAAGTAGTTTCCTTCCGCCAAGACGTAGGCGCTAGCAGCGACGTCGAAAGCGTGGCCTGAGTTGTCGTAGAA
GAAGTTGTTGGCGGCGTGCACCACGACGTTCTGGTCGGCCGAGCCGCCGATCTTGGGCGACCGACCCGAAGTTTCGTGGATGAAGTTGTTCACGAGACTG
ATCTGCGTCGTCTCTCCATACAGGAGGAACCCCCAGTAGTGGCGACCGTCGCACGACGCCGAGTACTCCGTGTTACCGTCCAAGTCCGAGTTGCTGATGG
TGAGGCCCATGGCGCCGGAGAAGTTGACGACGACCATCTGCCGCCCGATACTGGAGACTTTGACGTGGTCGACCCAAATACCCGACGGAGCCGTGTCGCC
AGCCCCGCGGATGGTGATGGCGTCGCCGCCCCAGACCAAGTGCGGGTTGAGCTGCGTGATGAAAATGTTCTGTACGATGACGTTGCTGCCCGTGATGAGG
AGGCCCTTACCGTACAGCACGCCGGACGTGCCTTCACCCACGAGCGTCTTGTTGCTGGCGACCACGAGCGGGTTCTTGGCGGCGTTGTCGTACGTCACTT
GGACGGAAATGCCGTCGCTGTCGCAGCCGCCGGTTTGGGACATGGCAGTGTCACCGTCCATGAGGATGACGTCCTGCGACTGGTAGCCGTTGTTCTTGGC
GATGCACTCCTGGTTGAAGGTGGGGCGACATCCCGACTCGGTGGTGGACCCCTCCGTACCGGTGAAGTTGAACGTCTGCAGCACGATGACTCGTGGTTCA
TCATCACTGAGGTAAGAAGACAGCTCGTCGGCAGTAGTGGGGTACACCGGTTCGACACTGCCGCCGCCGGTTGTGCCCGCCGCGAAACCGGGCGCGGTCC
CCGTGTCGATTGTGGCAGCGCTGGTGAATGCAGCAGCAAGTGCCGCAGTGACCACCACAGCGTTGA