Description :
From Genome Similarity Track
Location :
Scaffold_36:193372- 197547
Transcript NameFunction/comments
Physo_135130hypothetical protein
Physo_135131reverse transcriptase

Sequence
4175 bases(100 bases per row)
GTAATCGTACAGGAGGCCGCCGCACGAGAGATTGGACGCTGGTTCCCATGTCGGCTCGTCATAGCCGACCCACTTCACCTTGAACTCTCGGACGGCCCGG
TGAGTGCTCGTTGACAACGGTGTCCGGTCATCGAGGATAGCCTCGACTTCATACTCACCGTCCAGGCGGTCCGGCTCAAAACTGTCTTCAGGCAGTAATT
CCTCGTCGAAGTCAAGACGAGTGCCTTCGGTGACCTCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAACTCGTCCACTGACTTGAGTCGTGAAACATG
CACCACCGGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAATTCGTCGACCTTCTTCTTCACGCGGAACGGTCCGTGCCACCGA
TAGGCTAGTTTCTTGGTCAGTCCTGGTCGAACCCGCTCCATGTACAGCCACACTCTGCTCCCGGGCTGCAAAGAAAACCTCGTTCTCGTCACTGCAGCTC
TACTATGGTCACGGGAACTCGGTGCCCGGTCGACCGAGGTTCTTTTCTCGTTGACGCCTGCCACGGCTTCCTTCTCCTTCCTGCCAAGCGACGCATTGTA
CTCTTCAGCTCTCCGAGCCTTTTCCGCGGCTTGGTACTCCTTGGCCATCCTCAGGGCGATTTCCTGCTCTCGGTTGACCTCTCGGCGCCATGCTAGCGCG
TCAGTTTGGCCACCGAAGCCTCGTTTAAGTGACGAGGACTGTGCATCCCACCCATGAACGAGGTAAAACGGAGTTTCCTTCCTCGTCGTATCACGGGAGC
TATTGATGGCGAAGATCAGTCTTTCGGTGATCTCGTCCCAATCCTGCTGTAGTGGGTCTTCAGCGTATACGCGGACTGACTGCATGATCGTCTTCACCGA
TCTCTCCTACTGGCCGTTGGCCTGCGGGTGGTAGCTCAGGGTCGCTCTCGACCGAGACTGCATCATTTCCGCGAAGGCTTGGAAGACCTCGCTCATAAAT
CGAGGATCTCGGTCATGACGGATCAAGGACGGTGCTCCAAAACGTCGGTAGACACACTCCTCGAAAGCTTGCGCAACGAGTAAGGCGGTAGTGTCAGACA
TGGCTTTGCCCATCACGAATCCCGTGAACGAGCATTGGAATAGCAGGAGAGCCTTGTTGCCACGGCGACTCTTCGGTAGCGGTATCACGAAGTCCATAGA
GACTAGTTGGAAGGGTCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTGCAGTCAGGGTACGACTTAACG
TGTTTCTCCACATCGGCATACTGGCCGATCCAGTAATAGTCTCTCGCCGCTCGATGTAGCGTACGGGTAATACCTTGATGACCGCCTTCAAGTGAGTCAT
GACAGCTTTGCAAGACGTCTTGGATCATCGTTGTGGGCACCACGAGTCTCATCTTCAACTCGGCTTGCTCGCCGTCACTTGAACGACGGCTCGTTCTTGT
GTAATATAGCACATCGTCCTCGCTCAACACAAATTGGTCCGCCATTTTCCATGCATCTCGTGCTGCTCTGTATCCAATCTTCGCATCATCTCCCCGGAGC
ACTGCCTTCAGATTCGACCACCGTAACTCTTCATCTTGAGCGGAGGCGATTCTCCTTCGGCGTTCTTCCTGTACTACCAGCGGGTCAATGTCTTCTGCGT
TTGGTGGGGCTGGTGACGTCTCGGCACGCAGCGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGCACACCATTGGCTTCTACTCGGTGAGATGCGTC
TCCCTGATCGGTGACCGAGACTTCATATCCAAACCGGACGTGTTTCTCCTTTGCTCTCGTTTGACGTCTGGTCATCACAGCTACGTGTCCGGGTTCAGTC
TCGTTCTGCCGTCTGCGGTCGGTTTCTCTTCGCACAAAATCAAAAAAAATGCTTGCTACGAGGTTTGGCAGAAGCTACCACGGCCCATACTGTGTTGGCC
GAGGGTATGTCCTCGACGACGCAACCGTCAGCAGCGTCGTAGATGACTTCAGCGATACGGTTCAGCTTCATCAACTCTAATACTCGGTCGTCCGACGATA
CCACCGTAGACTCCTTGCACTCGAGAGTCTCGCTTGCCAGTCCGCCGCAGCGTTGAACTCTCTCACCACATGCAGGTACTTCACCGACCGAAGCTTGGCC
GTGAGTTCTTGGTGGCGGCTGAGTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTGCTGGATCGCGATCCTCAAGTCGCCAACGA
CAACTAGATCGTCGGCTCCATGCTGTAATGCATCAGCGACGCCGTTGTTCATCCCGGTGTACTCAGCGAGGTTGACCGTGGTGTTCTCGAGGTAAGCGCT
CGCAGCGAGCACTACTGTCCACTCTGGTAGCTTCCATAGTATCCACGAGCAACTGCCGTATCCACCGTTCTTCTCGGTTTTCGCAGACCCGTCAAACGAC
ATAACGAAGCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCGAGTCCAAACGAGCAGTTGGTGACCGGGTGTGACCAACGCCAGTGACTTATC
CAAGTCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCTGAGCAAACGAACAGTGGGTTTCTTTGACTCGTTCGACCAACAGGTGCCACGGCGACAGCAAG
ACGGCGAACTGGGTAGCCCGACCGAACAATGTCTTGGACTTGTGGAGTCGAAAACCGAGTGTAGACCCGGATTCGTTGTCCAACGAGTTGAGTATAATAC
ACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCCTCAAAACACGTCCGCAGAAGCGAACGGGGTGTA
GTTTGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCGAACAACATGACATGCACCTCCTTCTTCCGGTCGAAGTGTCGTAGTAT
CGGTGCTGCCGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTGGCCGCGGTGAGGTCACCCCCGGGCTGGAAGTCCTCGTCCTTAAGCTGGTACAGC
GCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTGCATTCCTTTCTTCGTTGACGGGAACGGAAGCT
CGGCCACCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACCTTCTGCCGAGACTTCGTGGGACAGGAAGTCTACCTTGGACTGCACAAAGACGCTCTTCGT
GAAGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGTCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGCACCGAAACAGATATCATCC
ACGAATGACCGGCGACTGAATACTGGTGTCAACGAGGAGTCATCGGGCTCCCTGTTGGCGAACATGTCGGCGATAGGGCTGTTGACCGGTTCGGCTACAG
CTCCCTTACCAAGCGAGTTGTCGCGGTCGGCCTTGAACTTTGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTT
GTCATGTTCTTCAGCTAGACGCATGCGCCCCGAGAATTTAAACCATCCTCCCGTCGGTTGGACAAAGCCCCAAAGCGCGTTGTCAATCATGCGTTGATAG
ATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAATCATTCGAAGTGCCCCAGTACGCAGACGACAGTAGAGATCTTCCGAGTTCGTTCGGTCATCA
TAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCCACCAGGGGCATGGCGTACTCCAT
AATCTCGTTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATATCCACCCCATTCTTCTTCAGGACGATGACGATTGCCGACGCTCATGGGCTG
TCCGAGAAGGAGATAAGCCCGGCCTTCAACAGACCCTTCAGCCATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGTCCGCCGAGCCTTCTGCTTGATTG
GCGCGTGCCCCTGTACATTGATATCACACACGACCCCGTAGGCTGGAGGCGGTAGGACGTTACCGCTCGCAATCA