Description :
From Genome Similarity Track
Location :
Scaffold_6:193359- 195500
Transcript NameFunction/comments
Phyke_g644hypothetical protein PHYSODRAFT_345966

Sequence
2141 bases(100 bases per row)
GGAGCTGAAGACATGTGCAAACTCGGCCACCTCCATGAACCTGCCATTGTGTACAACGTGAGGGAGCGCTTTCTATCCAAGGAGCCGTATACTTACACGG
GGAAGATCGTGGTGGCGGTGAATCCTTATCAATGGATCAAGAATCTGTACTCGGAGGAACTGCGGGACTTGTACACGGAGAGGCCATGGGACGAGATGCC
GCCCCACGTGTACGCGACCAGCGCAGAAGCTTTCCACCACATGAAGCAGCACCGCATCCCTCAGAGCATTCTAGTGAGTGGAGAGTCTGGAGCAGGCAAG
ACCGAGACTGTGAAGATCATGATGGAGCATCTAGCTAGTATCTCCATGGGCATGGCCAAGCGTCTACAGCCAACAGAGAGTGGAGAGACAATTGTTGTGG
AGAAAGTGCTCAAGAGTAACCCGCTATTGGAAGCGTTTGGTAACGCCAAGACTATCCGCAATGATAATTCGAGTCGATTCGGTAAGTTCACGCAGCTGCA
ATTCGATAGCGACTACTGCCTTGTTGGTGCAGAGTGTCGCCATTACCTTCTGGAGAAGTCCCGTGTGGTTGCACAGGCGGCAGGAGAACGTAATTATCAT
ATCTTCTATCAGCTTGTGAGCGCCAAGGAAGATACGTTTGGTTTCCAGGAGGATTCGTCGGCAAAGGAATTCCGCTATCTACAGGACGAACAACTCACAT
TAGATGGTAAGAGTGATCATGAGCGCTACCAGGTGACACGTGATGCACTGACCACTATTGGTCTCAGTGAAAAGGAACAGAAAGAACTCTTCAGTTCGCT
CTGTGGTATTTTACGCCTTGGTCAGCTTGATTTCGTGCCACTGGAGTCTAACAAGGACGATGCCAGTCAGGCTGTTGCTTCCTTGTCTACTGCTTCTGGA
GCCATTACCGAAGCCcagattgagcagcagcagaaggagattgagcAGTGTGCAAAGCTTCTTGGAGTGGAGGTGGCCGCATTGAGTaagcagctctgca
gccGCACGGTAAAAGCCAGGCAGGAGGTGTATTGCGTGCCGTTATCGGCGTTGCACGCTGGCAATAACCGTGATGCATTGGCGAAGGAAATTTATGCACG
GGTGTTTGGTTATCTGGTAAGTCGGGTAAATTACAGCATTTCAAACTCGGCGAATCGAGCGGCGTCCACGCCGTCGTACTTGCACGTCGATCTGCTCGAT
ATATTCGGGTTTGAGTCGTTCAAGCATAACAGCTTTGAACAGTTTTGCATCAATTTCGCCAacgaaaagctgcagcagaagtTTACGTTGGACGTGTTCA
AGACGGTGCAGGAGGAGTATCAGCAAGAGGGCGTGGCATGGGAGTTCGTTAAATACCGCGATAACCAAGACATGCTGGATCTGTTGGAGAACTCGATGGG
TGTGATGGCGCTACTTAACGAAGAATGTGTGCGCCCCATGGGCAGCGACCTGTCGTTTGTGTCCAAGCTCGTATCCTTGCGCGAATCGCATCCACGACTA
GAGAGGGCCCGGCTTAGTCAGACGCATTTCATGCTGCACCACTACGCGGGGCCTGTAACGTATGATGCAGAAGGATTCGTTGAGAAGAATAAGGATTCTC
TGCAGCCTGATTTACTGGAGCTACTTGGTACGAGCTCAAATGGTCTAATGTCGATGGTATTCAGCGATGATGGAGATACGGCTTTCATGACGGATGCTGA
CCTGGCTGTCCGGGCCGCCACCATGATGGAGGCTGGACGACGCAGTACAATGGGGCGgaaaacttcttcatttATGCAGGAGACAGTGAGCTACAAGTTC
AAAGCACAATTATCGCTGTTAATGAGCGACATTTCCAGCACTGAAGTGCACTATGTACGCTGCATTAAGCCTAACTCGGACAAGAGCCCAAACACGTATG
AGATCGATGCGGTGGTAAATCAGCTACGTTGCGCTGGCGTCGTGGAAGCGATTCGAATTACGCGTGCTGCCTTCCCTAACAAGATGGCTCACGAAAAGTT
CTTGCGCCGATTTGTGATGATGAAAGGCAAGAAGGACGCGGCTCTGACAACGTCATCTACTACTGTTACCGAAGCGTGTGAGCAACTCGCCCGAGAACTG
CTGAGTGGCGATGACTTTGCTCGGACCCAAGAGGGCAGTGA