Description :
From Genome Similarity Track
Location :
Scaffold_304:19332- 22903
Sequence
3571 bases(100 bases per row)
GAGCGATAACCATGTATCCACTTATTACGCGAAGACCTCACGGGGGGCAGGGCCTTGCGAGCAGTCGGAGAGAGGAGCGGTCAACGAAGTGCGGGTACCA
GGTACCGAAGATGTCGAACGAGTCGCGGGCGTGGGATATCATGGTCGATCTCAATAGGGGTGCACGCCAAGCCATCGGTAGATCGCGCAGTCGAGGCAGA
TGACCGCCAGCGAACGGAAGAGCGTGATCGGGACATCGCCGCAACCATGGCCTCGTTGACAGACCCAACGGAACGTTCGCCATCCAGTGCGGAGGAAGCA
GATGGGGGACTCACTCGCTTCTACTTCTGCGACCGCCTGGTCATCACCGACGGAGAAGTGTTTGTAATCTTTGACTTGGATGATCTCCGGGTCGTGGGGG
TCGGAGGTTCACGAACTTCTATGCAGGACGCGAGGTCTGCTGTGTCTTGGAGTGATCCGAAGCTGACCGTCTTTGGGTAGCGTGGTCGACAGCCGTGCGA
CAGTGGTTGGAGCTCCAGGAGGCGAACTCGGGGGAGCAGCGATGCGTGGACGCTTGGAGCTATCCGAAGCTAACCGTCTTTAGGTAACGGGGTCTGCAGG
CCGTGCGACTGTGGATAGAGCTCCAGGAGGCGAGTTCGGGGGAGCAGCGACGCGTGGACGCTTGGAGCTATTCGAAGCTAACCGTCTTTAGGTAACGGGG
TCGGCAGGATGTGCGACTGTGGATAGAGCTCCAGGAGGCAAACTCGGGGTAGTAGAGATGCGCGGACGCTTGTTCGGGGGCGGGACGGGATCGACCACCT
GTTGCTCCCTCCGCCGTTTGTCATACGCGAGTTCCACCGACGGTGGCAACCCGATGACAAAGTCTACTACATGGGCCAGCTGAGCTTGACGATCACGAAC
GAGAAGGTTCCGCTCTGCCCTCAAAAGCTCCAGTTCTTCAACGTGAGAGGCGTGGGAAGAGCGTAAATGATGAAGCTCCTGGTCACGAAGTGCGCGATCA
GTCTTCATGCAGTCGATCTTGCGAGCCTGTTCAGCAACACTGTGAGCAAGCAAGTAGTATCTCTTCTGGAGCGGGTCCACAAGCCCCTAACCTTCATCCA
CCGCTCGCTGCAACTCGTGGCACACTTGGGCCAGTCGGTCGGCTTCTACATGACATTCACGCCGCGCCGCACGGAACCGCTCATAATTGTGTTGAGCGAA
CTGCATGAGCGGGAACGCTATAGTGATCCAACCCCTAAGTTCTTGCTCAAGTTCGTCTCCACGTTTCTTCTGCATCCGCAGAGCTGTTTCCAGTTCCTGG
TCGAGGTGAACAAGTCCGCTTGGAAAGCGATACGCCGGTACAAGGAAGTGATCAGAGTCCCCACAGAGCTGCCGTCGTCGGATGGCGGGGTCCTACTCGC
GAGTCGGGAAGAAGTACCGAAGTTGCGTGGTTGTCTATTACACGACCACGGCTGGTGCCGGGAAGAGGAGCCGGGCCATCAAGAATGATGACATGGGCGT
CAACACCTGCATCAGCAGCGACCACGATGACCGGGTCGGTGGGCCGGCCAGCAGGAACTTCCGGCTTTCTCGGCGATGGACGCGCCTGAATCAACGACGA
GATCTTCAGGGCCGTTTTCAGATACGGCAGAAATGCGTGTTTGCTCGACAGCAGTTCGCCAACATGGGGCGTACCAAGGTTAGTGGGGACGCCGGCGGAC
ACAGCTGGGAGGTCGACCGGCTCCACGAAACGATCGGCAACGGCAGCGTCGGTCATAGCGGAGTCAGGTGCTTCATCACCAGGCGCTTTGTTTACACGAG
GTGGGTCACGGGTAGCAGGGACGTTAGTAGACGCCGTTGCAAGGTCGACCGGCTCAACGGGATGGTCGGCAACCGCGGCGTCAGTCATGGAGGAGTCAAG
TGCTTGATCACCAGGCGCTTCGCTCACACGAGGTGAGTCCCAGGCACAGGGACGTCAGCAGACACTGTTGCAGGGTCGACAAGGTGGTCAGCAGGAACGT
CTGCGGTTTCGCCGGGGTTGCGCGCTTGATCTCCGGCTACTTCGTCACTGCGAGGTGAGCCAAAGGCAACGGGGACGGTCACCGACACAGCGGCGATGTT
GACAGAGTCGGCCGGGTGATCGACAGGAACGGCTCCTGCCCCGACCGTGTTGCATGCTTCGTCACCATTCACCTCGACATTGGGAGGTGAGTCAAAGTTC
GCGGGGACGTCAACACGCACGGCAGTGAAGCCGACCGGGTCGACAGGGTGGTCAGCTGGGACAGCTTTGTTTCCGACAGGGTGGGCTGCTTGGTCGCTGG
ACATCACGCCACTGCGATGTGATCCAAGGTCCACGGAGACAGCAATGGGTGGAGAGCCACGTCGGCCGAGACGACGGGAAGGTCAGTCGCAGCGCTTCCG
GGTTCGGCAGGAGCGTGTCCGGGGTCATCAGACAGTGTGTCAACTTGGGGCGAGTTACGATCATTAAGACCTCCAGTGTCGCCGGTCGCGTCTAGCGTAT
GACCAGCACGTTTTTCATCATCAAGAACGGGGATGGTTGATCGCAGCAGGGCCGGCTGAAGGGGTGCTGAACCCGAAGCCAGGGGTTGACCAGCGGCGGG
GCGGGTTGGAAGCGACATCTCTCCAAGCTTATCGGATAATTAAAAATGCGAGAGTTGAACGGAGCATGTAAGTGAAAAAGTGCTTGCCGATTACTGGATC
AGGGGACGACTGTGGTGAAGTGGTCGGGAGAAGTAATGACCAATCGTATCTTTTCACATCATGGGTACATGCGGGATCGGTCACGCCGGCATTGGGACTG
ACCGCTAGAAACTTCCAACGGTACGGTGGAAAGTTGACAAGTCATCAGTCGCGGTCATAGACGGTGACCAGCGGTCATGTTGGCAGTTGAGGTGGGTCAC
TTCAAGCACAGGGAATGGGTGTCGGAGGCGAACGACGTTACAGAAACTGAGATATAGAGAAGTATAAGCGTAGTTCTAGCTCCTAATAGGTTGATAACGA
ACAGTATTGATTTTCGTACAAAAGACACGCATCAGCATCCCTCCGGGCTGGAATTCTAGTGGCCACCCTACGTTCAAGGTTTACTGCTCACGTGTTTGTT
CACGTTTTGTCCCTAGATTGCTTGGCTAGGGACAAGGATACTCATTCAAGTTAGCCCGCTTGATCGGACGCGGCAAGCATATAAAGGCAAGGTCTTCAGA
CGGCTCAAGTGATCAGAAGAACAAGTTGATCAAGTGGTCAGAAGAACAAGGGGATCAAGTATCCACATTTGGGCAAGGCGACCTCAAGGAAGGTCAGTGC
GACTCTGGGAGAGCACCACAACTAACTGTTGGTCGTATGAAGAATTCCCACGCGACCACACCCCACCTATCCCCAACTCGGTCAGGCCATACATCGCCCT
CAAGCCACCTAGAAGAGTGCAACCCTCCCGCCTACGGATACACAGGGTGAGAAAGAACAAGACAAGACACACGGTCCGGAGTCCCCCCTCCGTTAGTCGG
TCGTCCGGGCGCAAGTAAAGAGTTGGGATCGCTTCGCAAAATGAGCGAATCCCACTCTACCACAGATGTAC