Description :
From Genome Similarity Track
Location :
Scaffold_1381:1933- 4208
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1381-snap-gene-0.1Peptidase family M3

Sequence
2275 bases(100 bases per row)
GGACCGCTTCCTCTGCTCCTTCAGCCACATCTTTGCTGGCAGCTACGCGGCCGGCTACTACAGGTGTGCATTTCTCTGCTTGGCTCATTGGCTGTGCTGA
TCGTACTGTGACTGACTGATGCTGCATCGACGATGGACCAACAGCTACAAGTGGGCCGAGATCCTCGCGTGCGACGCGTTCGGCGCGTTCCAGGAGGCGG
CCGAGGACAGCCCCGAGGCGGTCGCCGCGGTCGGCCGGCGGTTCCGCGACTCGGTGCTGGGCCGCGGCGGCGGCGCTCACCCACTCGAGGTCTTCGAGGA
ATTCCGCGGCCGCGCGCCGTCCATCGAGCCGATGCTCAAGCAGTACGGGCTCGGCGGTGCCAGCGCGTAGGTGGGGCCGATGAATGAACGGCTATAGTCG
GTCGGATGTTGTCGGGATGGTGCTGTACCGTGTTGAAGTTGGACGAGGTTGAAGATGGCGCGGACCATCCTCCGGTTGTCGTCAGATGAGCTAACGCCAC
GGACATGAGAGGTGGACCAATCACAACACCGGAGCGCGGGACGCAACGCAACAGCGAGTTGACTGCGTTAAACGGACCCAAGCAGCGCTGACGTGAATTA
GCGCATTCGCATTTGGTTAGGACGCTACATTATAGAGTTTGTCATGGTGGAGCCTCCTCATGAGCTGATGGTGACAGCACCGGACTTTGCAGAAGAACAA
AGCCGCGCAAAACTTCAAGTTGCAATTTCAACGTGGCCCGTCAATCTCAGGTGCTTCCGCTCAATCCAAGTCTCACGAGGAATGCGATATCACAGGGTCG
CGGTAAAGATCACGCCGCTGCCGGCCGCGCGACGCTCACACCGAAGTTCCCTCAGTGGAGCGTCGCAGGTCGCGTCTCGTTCTGGCGATTTGCATGCGAA
CTCAACTATCATATTCCGCAATTTATGTAATTTGGAAGACCTTCCTTCGTTTTTCTTTGTCCCTCACCCTTCCCCACGCCGCGCCTACGGTACACCGAGC
GCGTGCCGGTCAGTTGCTGGGTGGGGACGGGCGGCCGTACCATGGAAGCGCGGGACGGCCGCACGGACACTCGACGGGATCCGCGCGCCATTTCCCGATT
GGTCTCGAGCATCATCATCCTCCGCTCATTCGTATCGCGATGCCGCTGCTGCTAAGCCAGCCCCTGGCGGCCGCGCCGCGCCTGCCCTCATGGTCGGCCG
CGGCCCCATCCACCTCCTCGACACTCAAGACCTTCGTCGTGCTGCGGTCCGCGCGGTCCGCGTCCAGCCTGCCGACCAAGGCTTCCTCCTCATCCTCGTC
CTCCTCTCGGCGGCTCTCGCGGCGCTCGTCCGTCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCGTGCTCGACAATGGGCAGCGACGACGAGCTCG
AGCCCGAGGAGGACGTGCGCGCCGTCCGCGTGGACGACGCGGCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGAAGAGCGGCGCGCAGCTCCGCTGGTGCGACCTGGACCGCGCGGCAGCCGCGCCGTGC
TCGGCCACGCTCGCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCATCACGATCCCCAAGCGGGCGACGGCCGCACGGTCGGCGCCGAGCCCCGCG
GCGCTCGCGCTCGAGCTCTGCTTCGGCTTCCTGGACCAGTGCGACGTGCAGGCCGCGGCCGCCGCCTGCCGCGCCNNNNNNNNNNNNNNNNACCACCTCG
GACGTGCTGCTGCCGGAGCTGTACGCGCGTCGCTGGCGCGCGGACGCGGCCGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGA
TCGCGGCCGTACCGGTCGCTGCTGCTGTTGGGCCACCGCGCGGCCGCGGCTAACAAGCCATACCCGCTGTCGACGCGCTGTACCGTGAGCGCCGGTCCGG
ACGGCACGATCCGCATCGCCAACCGGTCGATGCTGCGCAGCTTCGCAGCCGGCGCCGTCGACTCCGCTCGCGGTACACAGCCGCTGCCGTGGCTCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCCGCGTCGCCTACTACGAGGTGACGCTCGAGCGCGGCGGCGG
CAGCGTCGGCGTGGCCGGCGTCGACTCGACTGCCTACGGCTTTGGCTCGGCCGCGCACGTCGGCTGGGCGGGCGT