Description :
From Genome Similarity Track
Location :
Scaffold_1372:1933- 3632
Transcript NameFunction/comments
Phyag_g10433ABC transporter ABCA1 lipid exporter family

Sequence
1699 bases(100 bases per row)
GTATCTGTACACGACCTCGAGAATTCTAGTGGTTTTCATCcaagagaaggagctgcgtcttcgtgAGTACATGAAGATTTTGGGAGTGAAGGAGCGTGTG
ATTGTCGCCACTTGGTACATCACGTACATCATCATCCTGTTCTttggtgctgtgctcgaaGCTCTCATGGGCCTTGTTGGCCTCTTTGCGAACAGTTCGg
tgatcgtcatcttcctcttcttcttcttgttcggaCTCAGCATACTCTGCTACGGATTCTTCATCAGCACCCTCTTCAGCAATGCTCGGACGGGCTCATT
CATTGGCATGATCGTGTTTTTCCTCATGTACTTTGTGGCACAAGCGTTCACCGACAACTCGCCCGAGAACGACATTACCCAGGCGTGCATTTTGCCACCC
GTTGCACTTTCGTTTGGACTGTCTACTATTGCTGACTTCGAGACGTCGGGTATCGGTGCAAACTTCGGCAACCTAGACACACTCAACGTCAACTTCCGTC
TTGGTACAGCTCTGCAAATGTTCTTATTGGACTGCGTGCTGTACACACTGTTGGGTTTGTACTTCGAACGGGTCATCCCGAAGCAGTACGGTACGTCGCT
CAAGTGGTATTTCCCGTTTTCGCCATCGTATTGGCGTGGACGCAAGAAATCGGCGCCTCCCAACACGGCTGAGACTCCTACTGATTCACTTCTGGACAAC
GTTACGGTGGATTTGAACCCTCATATTGAGCGCGTGAGTGCTGACCTTCGCGAACAAGAGCGGCGAGGTGAAGCGTTGTCTGTGCAGCGACTACGTAAGA
GTTTTGAGGTTCCTGGCGGCACCAAGGTGGCAGTAAAGGGTCTGGATTTGGTCATGTACAGAGATCAAATCACGTGTCTACTTGGTCACAACGGTGCCGG
CAAATCAACGCTGATTTCGATGCTCACAGGCATGGCCGCACCAACAAGCGGTGACGCTACGTACCGCGGTCTGTCGCTGAATCAAGATATGGAGGAAATT
CGCGAGTCGCTTGGCATTtgcttccagcacgacgtACTCTTCGAGGACTTGACAGTGGAGGAGCACCTCATGGTGTTCGGGAGGGTTAAAGGGTACCGGA
ACAatgagctgcaggatctAGTGGACTCACAGATCGGTCAGGTGGGTTTGACTGAGAAACGTCATGTTTTGTCGAAGGAGTTGTCGGGTGGTATGAAGCG
CAAGCTCTCGGTGGCGATTTCTTTACTTGGTGACAGCTCCCTGGTGTTCTTGGATGAGCCGACCTCCGGAATGGATCCTTACAGCCGTCGCAGCACCTGG
GAGATTCTGCTCAACAACCGTAATGACCGCGTTATGGTTCTTACAACTCACTTCATGGACGAGGCCGATATCTTGGGAGACCGTATTGCCATCATGGCGG
AAGGCGAATTGCGCTGCTGTGGGTCATCGCTGTTCTTGAAGAATCAATACGGTGCAGGCTACAACTTGACTCTGGTGAAGGACGATGCCAAGTGCGACGA
CAAGGCTATTACCAACTTGATTAAATCGCACGTCCCGTCCGCTGAGCTGCTTAGCAACGTCGGCAGCGAAATCGCCTTCCAGCTCCCTCAAAAAAGCTCG
CCGATGTTTGCTCCCATGTTCACTGAAATGGACAACAAGATGGACAAGCTTGGGTTGCTTTCTTACGGTATTTCGGCGACGACGTTGGAGGAAGTGTTC