Description :
From Genome Similarity Track
Location :
Scaffold_14:193296- 194738
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_19799Hypothetical protein

Sequence
1442 bases(100 bases per row)
CGCACATCATCGAGTACCTCCTCGCGTGGCTGAGCACGGTCGCGCTCAACCGGGACACGTGCCAGTACATTTTAGCCAAGGACAACGTCGACCTCTTCCT
CGATATGTCGACGCTGATCCACGAGAACACGCCGGTCGCGACAAGCGACGTCAAGACCATGAAAAAGTCGGCGCGGTCGTCGCAGTGGATCACCAACACG
CCCAAGTCGATGGAGGGCGACGGCGCGCCGCCCAAGTCTGGCTTTTCTTACTTCAACTTCTTCAAGCAGTCGGTGCGCGCTGGCATGGACGAAACCGAGC
TCGACGAAGGCGAGACCAACATTGACGCGGTCGAAGAGACGTTTACGGGCGAAGTCTACTGGTAAAGACCTCTGACGGAAGCGTATAGGAGCCAAGATGC
TTGGTTCTAGGTATGTCATGAAGGACAACGACATGTCGAGCGTCTCAGGGCCGCACCCCGAGTCCATTTTGCAAGCGATCTGCTCGACCAAGACGTCCAA
CTGGAGTCGCATCCTCCTCTCCATGTACAATGAGCGGGCCCCCGAAGAACGGGAGTGGCGGCCACTTCTCCGCGTGCCGCGCGTCCGCTGGCGCCTCTTT
GTGCAAGCGCCGTTCCACGTCAATGTGTGCATCTACACGACGACGCTGGTAGATGATGATATAAGACACTCTGTCCACAACTATACTTTTGTACTAGGTG
CGCGCGCTCGTCGAGTGCGAGATGGACCGAACGTCGTCCGGCCTGCAGTACTTCCCCGTGCCGGCGGTATCGACTCAGTTTCGAGAAAACACAAATGCTG
ACGCGACAGTAGGGCAAGCGGTTTCTGGGCGACCCGATCTCGCTCTCCAATGTCGTGCAGCTCTTGCTGTGCAACGAAGGCGCGATCGTCGAGAGCGCCA
TTGCGATCTTGCACCGCCTCGTTGCCATGAACGATGCGACGGTAGACAGCAATATTGTCCATATCTTCTTGAAACAGACAACTTGTCTAGGCGTCCAACT
TGTACCGATGCGGCGCGATCTGGTTTATGTTTGCAAGCGCGAGCCGCGTCTCGTTCCTCGAGCACGCACTCGTTCTCGCGCAGACGCACCGCCGACAAAA
GGACATTGCCGGTCGCCACAGCATCCTCGAAGGTCTCTTGCCCGAAGCGCTCATCCGGATTCTCGACCTCGAAGGCCCGCACGTGTTTGCCGACGTCTTT
ACCATGCGCACGACGGACGGCCGCGTCATTTGGCTCCAAGAAATGCGCGAGCACCTCCAGCTCATGCTCCACGAGCACTTGAGTCCGTTCGTCGCTCGGC
TCCACCAAGACAGCACGGCGCAGTACGCTTCGTCGATCCTCGGAAAGGACTGAAGCATTTGCGTAGATTCGAGTACTCGCCGATGCCGCCGGTCATTTAC
CTCCAGCTGCGCGATGACATCTACGTCTACAACATGTACCTC