Description :
From Genome Similarity Track
Location :
Scaffold_254:19319- 22162
Transcript NameFunction/comments
Hyaar_Emoy2813216hypothetical protein

Sequence
2843 bases(100 bases per row)
GACCATGACTTCTCCTGGATGCTTATAGCTGGCGTACTACCAGACCATATAACGGGGGCTTAGTAAGTACTACGATCGTTAGACTGCTACGGTCAACAGT
TTTTTTAAATGCATTATTGGCGCTCAATCGAAGTGCAGTAGTAACTTTAACAGCTACTGTTTCTGTGCAATGGAAAATGTCGCATTTGACAAACTGTAAT
GGCATATCACTCTAGTACTGGCATACACAAGCATTTAAACACCTTATTTATCGCATGGAGGGATATAAAGAGATCGATGAAGTTATATATGGAGATATTA
ATTGCGAAGTAGATCGACTTCAAATTCAAGATTAGTGAATATTCAAATGTGGTATTTTTTGTTGACGATCACGTCCAAGACCGCGTCCTTGCACAATCGG
GACAGCATCCGGCTTCCGTACAACGTAGGTTTGACACAAAGCATTCCTAAAAAATTGCGGTAGTATAGGCAGATGCGTGATCTGATTTTTCTTGATTGTG
CGTGCCGTATCCATCAACAACAGACTAGTATACTGCCACATAAGTCTCATTGCTGGTATCAACCAGTATGGTCATCGCCATGATCGCTAGCCACTGAAAT
TAATTTTAAAGGTGACGGTAAATGGACAATAGTGACTGCGTGTCGAACTGCGACGCTTCCGCGACTCTTCCTCTAAATTAGTTCTGTCAGTTCTTTTCAC
TATCCAGCTTTAGCAGCAACCAGCCAAAAATTCCTTGTCTTGCCTCCCAGCAATTCTTCGAGCGACTTCTGAAAATGATTACTTATTATCAATCACATGA
GCAAGTATATCAGATCGTACAAACGTTTGGTATATCCGGTATGGTGTTTTGTTATTCACACATAAAGAGATCGATGAAACTGATAGGCGTATTATTGTAC
TCAATACGCAAAGCGGTAATACCGTACATTATCGATTACGGTTAGATGGTATCTATCGTAATAGGTATTCAGAGGGGCGGCGAAGTTGTGGTGTGGTACA
CCAGAAGAACCTTTATGAGGACTATTCGATTAGGTAGCATAGTTTCAAGGGTAACGACGTAAATGAGGTTTATTATCGCTATAAATCAGTAAATACACTC
AGTTCCCCTCTTGATCAGTTTAAAATACGTGTCTTTCTAGACGTCTCTAGTCGTAAGAGTTAAGAGACAGCATTAGGGCTAGTACTCTTGGGCATTAGTG
CCACGTGCTTCCTTGGAGTCGATATATCCTTGACCAAGAATAGAAGCTTACGAGCTTGTTCAGATACTTAAAGTTAAGTCACGAAGTCTGTGAAGGCTTG
AGATCTCTTAAGTTAATACTCGTCTAGTTAATACACTAAGAGACTCTACGAGTCTATAAGTATTCCTCTGACAAAGAAGTAAGGGTAGCTCCGTTACAGT
ACTGCATTGTTGAGTGATAAGTGTATGACCTTATGTCACCGTGCACGAAAAAGTTTATAATACACAGTCACGGTTCGACTCAATCGCTAGTATTCGTTAA
TCATATCACGGAATAGCAGTGACAGCACAATGTCAATGTAGCGTATGATAAGGTATACACGGATGTTGCAATAATCCCCTCACCAGAGCGCCAAGATTAA
GCACATGGGCCGTTGTAGATATTCACTCGATCACAAGTCATTACCGGTGTGGTGGTACCCCGACTTGACTCAAAATACACCTAGGCTCTGCGAGATACTA
TTACTGTGATCGCTAACCTTTTCGAAAATATCGATCAACCCTTTTCAGGTTCGAACGTTCAAGTGCGGCTAATCACACACTGATCATAAAGCATCGCAAT
CTTCACAGGAAATGAGCCTACGAAACAAGCAACGCTTCTGCCAAACAATAATGATTTGCCGCTCTACGGTGGAGAATCCAATATGCTAAGCTGTCATCCG
CTCCCATCAAGTACGGCTTTCTCATTAGATTGGTTCAAATAGAGGCTGCCCCATTCTATACGTGGCGAGGTTCCTGTGGAAGCATCCTACCGCATTTGAC
GGCACTCCTTACTATTAACCAAATGGATGCGAGCTGCGCAAACATCCCTGTGTATTTAGTACCAAAAGTACGACCCGTATACATGCGGTCTGTGGTTGTT
ATGTATAGTTGACATCTACTACATTTCCCACCACTTTTTTCACATAACACGTTTAATTAGGCCGTATGTCTCTCATATCTACTCTTCATAGGTGTCTTCG
TTGTTGGAGAGTTTATGTTCCTTCTTGCTGCATGACCACTAGAAGATTGCGCCGTTTAGATGAGCGGCATGTTTATAAAAGACAGAAAAATTTATGAGGA
GTGGAGGAGTTGAGGATTTGGGGAGACTCGGGGGCGTGAGAGAATGGACGGGTGCACAAAGGAAACGTGTCACATTTTGAGCTTAGGACCTAGCGAGCAG
GCCTAAGCTATGTCCAGGGGTGTTTATTTCTCATAAAATCAGCCTATCAGCTATCCAAAGTCTATTCGTGTTTGACCCTACATACAATATGAAAGCACCC
CCGCTCGTTAGAATGATCAACGGAATCGCCAGTAACCTATTTATGACACGACACTACGAGCAACTATGGAACACTTTCATCAGTATATTCTCGTTCTGTT
TGGTCAGTACAGATTATGTTCTGTCCTTCTGATGAAAGATACACTAGTCTTGTGATAGCATATCCAGATGCTTACATAATGCTTCGCATTGCCATTAATT
TTATCAGATGATATGCCTGGGCTCGTCAGCGTTCATCAAATTGGGTGGTACATACCACTCTGTATTGTGATTTCCAGTGTTTGCCTGCACCACGGTAAGT
GAAATGACCCTCTCATCACTAGCGTCGATGGATGACAATCAGC