Description :
From Genome Similarity Track
Location :
Scaffold_271:19314- 27374
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.16Phospholipase D; Pi-TM-PLD
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.17Phospholipase D; Pi-TM-PLD
Pytul_var.sporangiiferummaker-pug3_contig_271-fgenesh-gene-0.7SF-assemblin
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.19Serine/threonine-protein phosphatase

Sequence
8060 bases(100 bases per row)
AGCAGCTCTCTAGCAAGCGACCGCGGCAGCAGCAGTGTGGTGAAGCGACACGACGCTCGTCTCGTACGAGACCTTGTGGCGNNNNNNNNNNNNNNNNNNC
CGCCCGTCGCACCTTCGCTCCCATAGATGAACACGTTCATCAAAAACCACGTGAGCACCGGACTCCACGCTCTCTTCTCGAGCCGCACGATGCAGCCGCC
GTGNNNNNNNNNNCACGTCTGCCATCGCGTAGTGTACACCCGACGACCCAAAGTACATGTTGAACAGCTCCTGCTGCAGCCGCTGGACGCTCTCACCGGC
AAAGAGCACGCCGAGCTCCGTGTCCGTCGGCCGCGAACTCAGGCTGCGATCCGCAAGGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCAGCTGCTCCAGCGACCACTGAATCGACAGCGAGCAGTACAGACGCGTGACCTGC
GACGGCTCGTCCTGCTGCGCCGCATTCGTGAGGATGATCGCGTGGAACGGCAGGTTCCANNNNNNNNNNGACGACCGCAGCGCGTACGCGCCGTCGACGA
TCAAAATATTCGAGTGCACCTTCACGAGCACGTCGTGGTATTGCATGCGGCCGACGATCAGATACTTGCGCAGCACGTCGAGGGGCAGGCCGTTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCAAATGCGCGCAATGATCGCATCGCAAATG
CGGTTGTGCTGCAGCGTGCCGCCCGAGATCATGATCTGGTTTTCCAGGTGAATCGATCGCTTTGCGTGCAGAATCATGTTGACCATGGCGTTTTCCTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCATCCAGGTACTCGTCATAATGACGCTTCTTCGC
CACTGGTGTGTGGTTCGCCTTGATCCACTGAAACATCTTGGGCGTGCAGCGGCACACGACGCTGAGCTCGTGCCAAAAGTACCCGAGAAGGTTCGTTTTG
AGCCATCCTTCGCGCTCGGCGTTGACGTCGCAGCCCGTGACCATGATCACGGACTCGTCGATGCACAGGTACTTTTGATGGTGGAACGCATACTTGGAGT
TGTTGGAGAGGCACTTGGTGAAGACACTCGGGCCCAAGTCGCTCACGGAGCACNNNNNNNNNNNNNNNNNNNNNAAGTGCACCTCCGGTGGGAGCTGCTG
CTGCAACTCGGCCACGGATTCCGTGCCGTAGTCCACAACAGGGTTGTACAAGATGTGGACTTCGACGCCGCGCTTCACGGCCGCTTGGAGCAGCGAGATG
AATGTAATCGGTTCGCCGTCCAGGTCCGAGCGTGCGAGCACCTGGGTAAAGTCACAAAGGAACGTCGAGTAATAGACCGACGTGGTCGNNNNNNNNNNGC
TTAGCAGTTTCACAATGCTCTGCTTGCACTCGTCGAAATCGCGCATCGTCGTCACGTCCTGGTCGGCCCAGTCCATCTGCTCAAAGGTGAATTCCGTGCC
GAGCTTGTTGCTCTCGATACCATTTGGAGCCGTGCGCGCATGCAAGTCGCGGATCTGCGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTTGACCAGCAAGAGACACACGCCCGAGAGCGTGATCGCGATGCCTGCGAGGAAGCACACGACCGACAGGATGCTGTAGCTCGCCATTTCGTTGTAAAA
CACCATGCCGCAGATCATGTTGCCGATAATGATGAACGCCTGGTACAGCGGGATGAACTTGAGCGTCCCAAAGTACTCGAGGCCCTTGTTCAAGAAGAAC
AACTGCGGAATCAGTGCGCTTGGGATCCCGACAATGATGAGCACGAAGAACGGGTTGAGCAGGATCCCCCACGTGTGCTGGCTCAGCGCCGACTTGCTGA
CTTCGACCGCGGATTTGGTCGCGAGACTTGTGAACCCTGCCATGATGCCCGCGCAGGAGCTGAACGCCAGGAGCCCAATGGCGCGGTGGTGGAGGTTGTT
CGTGTGCACTTGACGCAGGATCGCCATCGTGTACGTCAGCGCTAGCACCATGTATCCAACGGGAAAGATCGAGTCGCGGAAAAACAATTTCCCTAGTGTC
TTTAGCGTGTACGACTGCTGGGGCACCTCCGAGAGCTGCGCGGCAAACACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACGCC
GAGCACGATCAGCACGCTAGAAAAGAAGTCGTAAATGAGGAAGTCTTCTTGGAGCACGAAGTGACCCAAGAGTGCGCTGTAGATTAACGTCAGCGCCGCG
AATGGAGCCTGTACAGCCTGGCCGAGGATGCCCAGGTTCAGTACCGCCGAGATCGTGCCAACTGCCAGCAGAAACAGCCCGAGCACGAACGTGCGCTGTT
GCGACGCGACACCGAGCGTCGGATTACTCTTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAACACGCCCGCGTACAGGTACAGCTTGGCCGCCATGTCGGGCGACACGTACTGCGTCGCGTCAAAGTGCTTCATGTGCTGGACGACCA
TGAGCGCGCCGATCCACGTGAGGGTGCACACGACACTCGCGGACATGAGCCCGACGAACCATCTCGGGAGCGCCGCGAACGCGTCTTTCTCGTCATCGCC
ATCAGCAACCGCGATGCGCACGGCATCGTTGTCCTTCGGGGGGTTGAGCACGGACGCGATGCTCTCGTAGCTGCGCTGCGATTGAAGCAGCGGCGACGTC
TCGTGATGGTGCGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTATGCGCAAAAAAGGAATAGTGAGCGTCCCTGATTTTTCGTTTTCTTCTGTGGAGCAATCACAAGATCTGATACGACTTTC
AGCCAATCCCCACACCGCAGCCACCAAAATTTGGGATAGTGGGGATAGTGTGGGCCACATGAAGATCGGACAACTTCAACGTGCTTATTTACGGGAGCAA
AGGTGTGTAAAATACGGACGTGGCAGCTATATATTGTCGCAAGTTGTTATGCGTCGGGGCTCGTGATGACCTTGAGGCTGTCCTGGAGCTTGGCTGTGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGCTTCGACAATTTCGTCGTCTTCGCGCTCTCGGGACTGTTGTGTGTGCGTGGGCGAAGCGAGAAGA
AGTCAGTCCACGTCCTTGTGCATTTTGTTACAAGCACAACATGCATGTACCTGGGCCTCGGCGACGAGCGCGTTCTGGATCTTAGCGATCTCGTCCTGCG
CGAACGAGTGAAAGCGGTCGTCGCCACGCGTCCGGTTCGTCGTGTACGCGTCCAGCGCGTTTTTCAGCAACGAATACTTAAGCTCACGGTCGCGCTAACA
GGCATACACCGCAAATACAATACAGAATCATTTCATGGTGTCTGGCGCAATACTCCAGAAGCAGAAACCGCACCCGCTCTCGTTCAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCACGTGCTCATGATCGCCGAACCGCTTGAGGATCGCCTCTTCCTGCGCCGTGCGACGCTTGCGCTCGTCTTCAAACNNNN
NNNNNNTCCATGAACGCGACGAGCTTGAGCGTGAGCTCGTTGGTCTTCTGCTCGATCATCGCGGGGATATCGACCTTCTCCTGTGCCACGAGCGCCTGCA
GCGCCGCGATCTCCTTCGCGAGCGAATCCAGTCGATTATGCACTTGCGTCGCGCGGTCGTGCAGCAGGAGCTCGAAGTTGGCCGTCATCTGCGCCANNNN
NNNNNNNNNNNNNNNNCTGCTCGTCGCAATAGTTTTGCAACGACTTGTTCATCTCGACGCGCTTCTTGATCTCGGCCTCGAGCTTGTTCTCGAGCCGTCG
CANNNNNNNNNNCTCTTTGCGTTGCTAAAGTGTAGTAATTGTTATGTGCATCACCTATGCATATGCACGTGCAGAAAGCAAACGTACCCGCGTGCCGATG
CGCATGACGTCGTCGAAGGTGGCAAAGTCCGTCATGAGCTTGTCGAGCTTGCTCTTCGTGGCCGTAGCACAGAGCTGCTCGGCCACCTCATCGCGCGCAT
CCTCCTGTTGCCGCGGTGGCGTGGTGCCCACGCTCTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGCCGTCGGTTCATTCGCGCAA
TACTGAAAAAATGAAAAATGGTACCAAACAAGCAGTGTGTCGCTTCACAACCTGATGAACATACTGAAAAGAGATAATAAAGTTCAAAGAAACAGAAGAC
CGAACTACAATACTCTCTATTTTTAAGTTACACGCTATTCGTTAGCAGCATTTGCACTTGGAGTCGATCACGCGCAGGCTGCGCAGAAACAGCGGATACG
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGATCACGTTCACGACCGCGAGGAACTT
GTCCCTGGACACGTACCCCGCGCGCTTCCGATCGAGCATGCGGAAGAGCAGCTTCAGATACAGCCGCTGCTCATGCAGTGAGTGCTTGACCGAGTCCACG
AGCGTCTCGGCCCACGTATTGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCAAACACCTCCCAGTCCAGCCCGCGCTGCTCTTTCTCC
TTGCGCATCGTCACACCGTAGTAACTGCGCAGAATTGAGTCGTACAGCAGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCGTAGGCGAAAGC
TTCATGGTCTTGGACGCTGCGAGAATGTCGTCGATATCCAAACGCGCTTTCTGTCCGCGGTCAAACGCCACAAACGCGCCTTTGAGTGACTCGAACTGCG
TCGACTCCTGCAGCCGCGAGCCAAGCTGATGCAGCCACTCGATCGCCTTCACGTCCTCGCCGTCAAACAGCGTCTGCAGGAAATCTGACTGACTCACTTC
CGCGAAGAACGTGCAAAACTCGCCAAAGTCCACAAACCCGTCGTGGTTCTGGTCCATTTGCTGCATCAGCTCGAAGATCTGCTGCTCCGAGAGCGTCTCC
GTGAGCACCAGATGGCGCTGCAGCGTGGCGCGAAACACGTCGTACGTCACAAGGCTGCTGTGCAGGTAACTCTCGTTGCTGCGCTGCAACGCAAAGTTAA
TCGTACTGCCGCCATTCGTCTCGGGTGGTGGCGACCCATTCACATTGCTATTGTACTGCGATGTGAGCTGGAAGAGCTCAAATGCGGCCTGGAGCTTGTT
CTGCGACGTCATCTTCGGATCTCCACCGCGCTGGGAGCCCCCTCCCCCTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAACCCCAACCAG
ATCTCCTGCGCGATCTGCTTCTTCCAATCCGCGTTCCCACCACCCAACTCCACCGTATACCGGTTCAAAAATTTCTTGTAATCCACGCCACCTAGTGCAT
CTTGCTCTAACGTCGCAAGTTGGCGAAAGTACGACAGAAAGTTCACCTCGATGCCGAGGGTGCGCTGCAGCACGTCTTTCCACTGAAGCTTCGTGACTCG
GCCCGTGCTACTGGCATCCACACGCGTAAATGCGGACCAGAGAGAGCTTTTCTTTTCGCAGATCAACTCCACGAGCGACATGAGCGTGCGCCGCTCCAGC
CGCAACGCCTTCTGTCGCCACTCGTTCTTGCCAGCATCGCGAAGTTTTTGCAGCGGTTGCGCATAGTATTGCACAACGTGAGGCTTCACGTCCCCGTGCT
CCATGGTTTGCAGCTGCACGAACGCGCCTTTGTTCGTCTGCGATCCACAATAGCTAGACGCCGAGAACACCGTGAGCAGCAGTCCGTCGTGTGCGATCTC
GTACCCTTCTTCGCGGCATTCATGCGACCGGATCACGAGGCACAGATGGTTGAGCTGACAGAACTGCCGCGTGATATCTGGTCCAAACTCGACGCCTGCG
CCTCGCCCAGATGGTTTCCACCCATTACGGTCGCGCGGATCGCTCCAAAGCAGGTGCGTAAACAGTTCGTCCTCCCTTTCCGTGCTCTGCGTGGGGATCT
CTCGCTGGTGCTTGATCTGGAGTAGCTCTTCAATGCGTACGTTGTCGTGGTGGCTAAGGCCGCCGTGCACCACAAACNNNNNNNNNNNNNNNNNNNNNNN
NNNCGTTCACGAGCGAGAAGATCGGGAACAGCGTGAAGATGTCTTCGAACATCTGGAACAGTTTCATCGGCGAGTAGTTCGCCGACATGCTCAATCCTTC
CCACCCGAGTGTTTCGTCGTTGTCCGTGTTGTACTTCACGTACACTTCGTCCTCGAACCCGAACACCTCGTTGATCATGCGCTCTTCGTGGTTGCCACGG
TTCAGGAACACGTAGTTTGGGTACAGCAGCTTGAATGTCAACAGCAGCAGCATCACCTCCACACCATGCGAGCCGCGGTCGACAANNNNNNNNNNNNNNN
NNNNNNNNTGAACAGATACCACATCTTCTGGCTCGGCACGCCGTTCTTGTCCAAGATTGTCAGCAGATCTTCTAGTTGCCCATGTAGATCGCCGACAACG
ATGAGCGTCACGCCCGCGGGGATCTCGATCGCGTTCATCGGCGACGAGTGCACGATGCGAAACATCTTTTCCGACTCTTCCAGAATGTGATGCACGTACA
CACGATGTAGCAATATGCCGTTGCGGAATTGGTCGATCAACTTCGTCACCGTATCCAGACGAAGCGGAAACACGACGTGCACGCCGCGGTAATGCACGAG
CGACGCGCGCACTTTGTCGCTCTCAGATTCGTCGTCAATCGGAAACTGGAACGTCTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCGA
GCGCAGTTCCGTGATGCTCGTCGATTTGTTGAGAATGCGGACCTGCACAACGCAGCAAGCAGCATGAACAAAGACATCATTAGTCAGCCTGTTCCACAAA
AGCAACAGCTAAAAACGTTGGCTACGCACCATTTGAACCGTTTTCTGCTCTTGCACGGTCTCGAGAAGATTCCACGTGGAAAAGTTGAGTTGTGTGCGGA
AAAGCGACTGCGAGAGATGCAAGCGGATCGCGTTCTTGATGCGGTTCGCTGACAAGACGGCCTCCGAGTACAACTCCACAAATTCGAGCGCGAACTTGCG
GACCTGACCCGATTTCTCCAACTCCACGTTCACGTACGCGCGTCCGCCCTCGGAGTCGTCTGTTGCCTCGACTTGCACCACGCNNNNNNNNNNNNNNNNN
NGGCCGGGATAGATGCCATACACGAGCACGCGCGTGTCCTTCTTCAGCGACGAGCGCTGAATGCGCACCGGCGAGCAATCGCGACAGATTCGCACTTCGT
CATAGTACCCTTGCATCGGCAGCCGCGGGACAAACACCGAGCACTCCTCGCACATACACG