Description :
From Genome Similarity Track
Location :
Scaffold_53:193132- 198040
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16077myosin-like protein
Phypa_INRA-310PPTG_16078myosin-like protein

Sequence
4908 bases(100 bases per row)
CATGCAAATAAATGCATCGATAAAGTCTCATCCACGTTAATGCTGACAAAGTTTTTGCGGCTTATAGATGAAGCAAAGACAACTGTCGACGGAACTTCAT
TCTCGTTTTCTACGAGTTGACTTTTATATGTTCGGCGGGGTTAATATACCGGAACTTTTAAATCCATAAGCCGCTGCTGCTCAACGGAATATCCGTGACA
CCAGAGCAACTCAAGAAGCCACTCGAAACACTATCACCATCGTCATCTTCCCAGTCATCCTCCTCCCAGTTCTCTTCCTCCTCCTTCTCACTATCGCTAT
CATCTTCATCTTCCGTGTCCAAGCCGCTGGCTCTTCGTACGATTTTCACAGCCTGCTTCTCTGCGGCATGGGATTCCAGAATCAACGACTCGGCACGATT
GCGTGCTAATGCCGCTGCAAGCTGACTCGCAACGAACGCCGGCACATCGTTTGCATCCAGAGTCAACGTTTCCAAATGAAAGTTGACGTCCAAAGCGTCT
AGTAGTGCCTGGGCTCCCACCTTCGTGACCCGGTTGTGAATCAGTTCCAGAGATTTGAGTGCGCAGTTGCAACGAATGGCCTGAGCGAGCGCTGTAGCGC
CACGATCCGTTATCAAGTTGCTTCTCAAACACAGACGCCTCAACGAGTCGTGTCCGTACAGTGCTTGTGCCAATGCTTCAGCTCCTCGATCACCGATGTT
GTTGCCGTACAGATCCAGATACTCCAGAGTCGTGTTGTTACACAGCATTTTCGAGAGAGCGACAGCTCCATCGTCTCCGATAGCATGATCCCGGATAATA
AGCTTCCGAACAGTGTGGTTGGTCGACAGAGAGCGTGCCACAAGAGCGCATCCTTCAGCTTGTAGCCGTTTATTGCGCTTCGCGAGGGTGGAGAAGTCCA
GCTCGCTGACATCACCATCGTTGAGATGGATTCGCTGCAAGATCGAGCCCAGCGTCGGGCCTGTGCGCAAGACATAAACAGCATAATGAGTCAACACCTT
TATCACAATCAACAAAGGGATAGCCTCCACTGACCTTGCACCCGTGAAATGTACTTGGACTGCGGCATCTTCTCCGGCGAATAACTTGATCGATTTTCTT
TGCTCACACGACGGGATAGTGGTGGCTTGCCAACACAATTGGTCTTACTTTCAGAGGATGATACGCTGAATATGGAGCTCACGGACGATGATGTTCCAGT
TGTGCTTGTTGACGACGGAGCTTGCTCCGCTTCCGACTTCTGGAATTCGTCAACGCTTTCTGAGCTAGCAGATTGATTGCACTCTGGGTTATCGTCTGCA
CTTGCATCGTTGACAGTGGGTACTGGATTCAACTCGTGCTCGTGCTGGTCCTCATTCTTCTCTTTGCCGTCGCCAGCAGCTTCGGTCTCCGTCTCCTGGT
TGCAACTCTCGCTTTGCGCCACCGATAAAGATCCACAATCAGCGCTGCTGCGCTTGTCATCACAGCCACGATCAATCTCCTTGACGGTAGCACCGGGGTC
CTCCATTTCCGGGTCAAGCTCTAGATTTTGAATCCGTGGTGCGACCTCGACGGAACTGGCGGGATTCCCATTCTCTGGCTGTGCATCGTGGCTGACTTTA
GCCTGAGCAACGGACTTGGATCGAAATATCAAGCGCCTGGGTCGGTCTCCCAGCAATTGGCGCCAATAGCGCTACGGTCGACAATTTAAAAAAAGCACCG
GTCAACGTCACGCAGGACAAGAATAAGATGCTAAAGTCCAAAACTCAGATGAAAACCGAGAATACAAACCTCGAGGTGGACCTTGGCACGACGGAGATTG
ATGTCGGGCATCAGTAATGCCATCTACGCCGACTTATCGGCAGTGCTGCTTGCTCCTGACCACTCCGTTTCGAAAAACTCGAACCTTCGCTCTCTAACAA
GGCAAAGCACGCACGGAACTCCGATGGGGATGCTGGCTGAAACCACACAAAGCCTTCATGTCCCCAGTAACTCACAAGAGAGAGAAACGGCTTCCATCTG
TATGATGGACAGCACTGCGCATCAGCGTGAGCACAGCCCGAATGTCCTCTCCCGCGGTAGTTGAGAAGGAATATGACAGAGATGTCAAGACGAAAACAAG
ATGCAACAACAAAAGTAAAACTACTCAACGTCTTCACATGTTGAAAGAGAAAACTGTTCTGGTCTTTCGATACAGATATACGCCTTGGGGGCGTTTACTT
AAAACTGTTCTTGTCACCTGGCTGCGGCCTTGACTTTATGCTCAACTCGCAGCGAGGGATACATGTCGTCACGCCATTTTTACCTCTTGCGGCTCTTGTT
GATCTCGAGAATGATGGCTTGCAACTCGATGCACTGCTCACGCATCAGTTCCAGATCGTATTTCAGGTTGCGGTTCTCGATCTTAAGCATCGAGTTCTCA
TCCTCCAACGAGATGCCGCTCGAGCTCGAAGTACTGCCACTACCGCTACGCGGCTTCATGAAACTCTTGGCACGCGCCGACAGTTCATTCAGACGCTTCA
CGCTGCCACGACGACCGGAGTGAGCCACCTTGAACGACTCCATCCTGTCCGCAATTGACCGGCCGCGTCCAGCACGGATCGAAGCCGGATCGTCGCCAAA
GCCCTCGTCGGCATCCGAGTCGTCAATGTCGTCAATCTCATCCACCCACTGACCACCGTTGTTGTAGTCCTCGTATTCAGGCTCAACGGGGATAGATTTG
TACCTCTTCCAACCACGCTGAATCTTGATGATCGCACGACGCTGGAAGTGATACTCCTTAAAGTCCAATGACATGCGAGCATATGACTGCAGTACAATAG
CAGCACGGATCTTGTTGCGCAGACGGCGACGTTCCAAGAAGCCCAAGACGATACGCTGAATAGTACGTGCTTCGTAGTACATGAAGTCGGACTTCATGGC
CTCCAGCTCTTCCATGACACCGTTCTTGAAGTAGATCAGCGTCTTACCCATCTGGTATTCCAGCGGGGATTTCCGACCGATCGATGTCATGAAAACGCTG
CACGTACGACGGACATCCTTGCTGTGCATGGACGGCGGGAACATGATGGCGTATCGCGTAGCGAGTTCCTTCGGGGTTAGACGACTTGGGTAACCAGAGC
GAGTAATACGAATGGCTTCGATCACACCGGCCGATCGCAACTGCTCCACGATCATGCGCTTGTTGAACTCCGTCGGACTCTTGTTCGGGTTGGGCTTAAT
GCAACGCACGTAGTGAGTGTTGGTGGTCTTGATGTTGTCCATCAATTGCGCCAGCGACGTCTTGAACTGCGAGCCTAGACTCTTCGGGGCCTTCTTGCCA
CGTCCACTGCCACCTTCCGTGGTCGCCTCAGCGTCTTCGAAAAGCTCCGGAAGCAGCGAAAGACTGCTGAGCTGGATCAAGTCAAGCAGATCCTTCTGCA
ATGTATCGCGGTGTTTCTCCATGAATCCCACCGTCTCGTACGTGACGGAACCAGCGTAGTGGTTGATGATGAACTGCGTACGCTTCACCTTGGGAAAGTC
AATACTCTCGTTCACACCGCCACCCTTCTTCGTCTGATGGTTCGTGCGGATCTTGTTGACCAGAGCCTCTTCTGTGTCACGGGGCTGACGAAGGTGGTCG
TTCATTAATGCAATGATACCCATCTTACCTTCGATCACCTCCACGATACCTTGGTTGTCCTGGTACTGGATGTGATCCCACTGCAAACCTTCACGGATGT
ACTCGTCCTCCACAGTCTTGAAGACGTCAGTAGTGAATTTCTGCTGCAGCTTCTCATTCGCGTAGTTAATACAGAACTGCTCGAAGCCATTGTGAACAAA
GTCCTCAAAACCAAAGATATCCAGCACACCAATCTGGCCCTTGATGCGGCTCTCGTCCGTGCTGATAGCAGCGTTGATCTTTACCACCATCCAGTCGAAC
ATCTTCGAGTAAATAGTCTTAGCCAACGCGTCACGGTTCTCCGCTGCTTCCACAGGAGCCAGCGGCACCGTCACACTGTCGTTGCGAGTAATGACCGTGC
GGTTGCACAGTGCTTCCTCGATTCTCGTGGTGGGAAGACCAAACATCTTGGCAACCTGTGACAGCGCCGAACCACTAGAAATGCGCGACCCGTTCTCCCC
ACTCTTGTCGAACATGACCTCACCCAGCAGCAGTACACCAGCCAGGATCTTGAACAGCGTCTTTTGCGCCTTGTCGTCCAGTCCAATGATGGACAGCGAC
TTCTGCGTGCCTGCAAACCACTTCGCGTCGTCCAGACCAGGGATCTGCATTTCCGCGAGGGAACCAGCGTATTGGTATTGGCATTCAGGGTCCAGACCAA
ACTCCTTGCGCTCACGGCTAGGCAGACCCGCCAAAAGCTGGTAGAAAATGTGGTAGTTGCGCTCACCCTCGGCGATCGACACCACACGCGACTTCTCCAG
CAAGTACGTCTCGCACTTGGCACCGATGAGTTTTCCTCGGCCGTCGAACTGCAGCTGCGTGAACTTACCGAACCGCGAACTGTTGTCATTCCGTGTCGTC
TTGGCATTACCGAAAGATTCGAGAAGCGGGTTCACGTCAATAACCTTCGCGATAGTCTTGTCCTTGCGGCCACCAGCCACACTGGCCAAGTGGTTCATGA
CAATCTTGGTCGTTTCAGTCTTACCGGCACCAGACTCACCACTGACCAGGATACTCTGGTTCATTTCGTTAGTCTTCATGTGCTTGTAGGCAGCTGTAGA
CGTCGAGTACACGTGCGGAGGCAGCGAGTCACGTGGCTTCTTCAAGTACTGCTCGTGAAGATGATCACCATAGAGGTTATCAATCCACTTGTACGGGTTG
ACAGCGATCACAATGTCGTTGGTGTACGTGTAGGGCTTGGAGGCGGCGAAACGCTGCTTCAAGTTGAACAGAATTGAAGGCTCGTTTAAGTATCGTAGCA
AACGCATA