Description :
From Genome Similarity Track
Location :
Scaffold_55:1931- 4736
Sequence
2805 bases(100 bases per row)
AATTGAACATTGAGATTGCTGCGAGTGCGTACCTGTCGTCCACCACAGTTAACATCGCCGAGTACACCGGCATGAACAATGGAGTCTTGGCGGCGATTGA
CCGAGGGATAACCGATCTGATTATCGTGGGTGACTCCCGGCTTGCAATCCAGCAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAGAAGAAGGCTTGTCTGGAGCGTCTTCCTCACCCTCTTACCAGGGCACGGGGATGGGGTCGGGTGCCTGGCATCTTTACCAAG
AGGCGTTTGCCCCAACCAATGTTGACTTCCTATGAGTCAGCCTGGCGCAGCGTGGTACTGGGTCTGTCGGTACGAACATAGCCGGAAAATGAGATCTCGA
GTGCTTCCCCACCGAGTATGTAAAGCAAGCTAGCATCGTTACGCTCATCTCTTACGGGCCGTTTCATCCAGAACCTTGGCTGTTTACGGAGCAGTACTCT
ATCAGCTAAAGGATACGGACTTTGGCCCTGGGGGTGACCTGGCGTCAGCAAAAGCATCATTCGCCGAGCTCAAAAGACGGGTAGCAGAAGCTCCAATTCT
GCGTCATTTCGACTCGGCGAAAGAAGTCCATATAATGTTGTACGCCAATGAGTGGGCGCTGAGCAGTACGTTGATGCAACCACACGACGACAAGCTGCAC
CCAGTTCGCTTCTGCGGACGCGTACTAAAGGAGAACGAACTCGGCTATCATCCCGCTGAGAAAGAAGTAGTCGCGCTGTTGCAATTGCTGAAAGTGTGCT
ACACTCTCTTGGCGGGAAAGACGCTTCACGTCTACACCCGTTTCTCCACGTTGGAGTGGGTGTTTAAGTCAAAGTCGCTGTACGGTCGCGCAGTCAGTTT
CGCAGTTATGTTGTCGCCCTATGATTTGAAGGTGAAGCGAGTACGTGAGCGAGATGTAGACTTCGCCCAGTTGCTCCAGGCGTCGATAACCCCGTTTATC
GGACTCGACGATTCCTTGAAGCACGTGGCACCTCCCTCCAAGAACTCGGCGACAGTTCGAATGGACCCAGCGTTGCTATATGCCCGAATACCAGCTGACT
TTGCAGGATGTGTGCTGTCATTTGATGGCTCAGCGAAGACGGCTAAATACGGCGGGTATGGCAGTTGCTCGTGGATACTGTGGCGCCTTCCGAATTGGGA
CATTGAGATTGCTGCGAGTGCGTACCTGTCGTCCACCACAGTGAACATCGCCGAGTACACCGGCATGAACAATGGAGTCTTGGCGGCGATTGACCGAGAG
ATAACCGATCTGATTATCGTGGGTGACTCCCGGCTTGCAATCCAGCAATCCATGGGGGTGATAGCATGCAAGAAGGAAACGTTGCAAGTGGAACTAGCTC
GGCACAAGGATCTCACGAAACAACTCAGCTCGGTCCGGTATCGACACATAGCGCGACACTATAACGCAGCGGCTGATTCTCTCGCTACAGAAGCACTGGA
AGCTAAAGCTGGACGAGTAATTCTTGGGACGGATAGGAAAGCAGAGCTGAGAATGATTAACCGCGTAGCCGAAGAACTGTACGCCACAGACAACCCAGCG
AAAACACCGATTGTCACGGCAGTCACTCGTAGCCGAGTACGCCGAGTTCACTTTGAGGACGAGCTGGATGAAGACTCGGCTAGAGCAAGAGGTGGAAGTC
AGGATCATGAAGCCATGTCTACAAATCCTGGAGAATCCGCGTTTGAAAGCAGTGGAGATGAATTCGAACAAGTCAGCAGGGCGTCGACTCGGCGGATTAA
CCACACGACCCCGAATGTCGAAACAGGGTCGCAGATGGAGTCAGCCCAGACAGCTCAGAATGCCAACGACATTGATCCAGTGACGATACAGACTAAGCGG
AGACGACGAATCGCGAAGGCACAAGATGAAGAACTCAGGTGGGCCGATCTGAAGGCGTACCTGAGAGGTGAATTGGAGGACCTTACACACCGTCGAGCTC
AGAATGCCGGCAAAGTCGCAGAAGTCTTTGTACTCAGCGAAGACGGCCTGTTATACCGCCGAGATGAAGCCCGCCGACTAGGCGAACTCGGCGAACCGAA
CCTCTCATTGAGATTGGTGATTCCGTCAACCATGGTCGACGAAATACTTCATAACTGCCACAACTCGATCGAAGGAGGGCATCAAGGCATCGTCAGAACG
TATCA