Description :
From Genome Similarity Track
Location :
Scaffold_46:193063- 194118
Transcript NameFunction/comments
Physo_136504reverse transcriptase
Physo_136505hypothetical protein

Sequence
1055 bases(100 bases per row)
GCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGTGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGAT
GACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGACCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTC
GCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTT
TCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACTCGCAGACGGATGGCCAGACGGAGCTCGTCAATCGCGTGCTCGAAGACACGCTTCGC
AGTATCTGCGCGGAGATGCCCCGCGCTTGGGCTGATCGCTTGCCCATCGTTGAGTTCGCACTCAACAAAGCGGTACATGCATCGACGGGCTTTATGCCCT
TTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTC
CTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCTGGGTGCGAGACACCATG
GCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAA
ATCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCGCCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACAC
CATAGACTTGACCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACTATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCG
GTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGAG