Description :
From Genome Similarity Track
Location :
scaffold_9:193041- 194219
Sequence
1178 bases(100 bases per row)
GTTAACATGGGCaatttgtactttgtaccCAATAATCCAAACAGTACACGCCAAAAGTTTGACGTGAACAGGCGTCACGGTCCGACACGATCTCGTCAGG
AAGcccatgcagacggaaaacaaCGTCTTCAAAGGCTTGAGCTGTTTTTGCAGGAGATATTTTATCCGTAACATGCGCAAGATGGGCCATCTTACTGAAT
CGATCTACTAACACAAGGATGCCACTGCGTCTATGTGTGTCACATGGAGGTCCGATTATGAGTCCATCTGACAGACATCCAGCTGTCAGTTCGTAATACC
AACGACCGAAGTGGGGTCTGTGTGGAACCTAATAATTTTACCCTTTAACAAATCCACAAGTCCTCACATACTTGCACATCCACTTCTACATGTGTGGCCA
ATAGCAATCCCGGAAAAGACTGAGAAACGTTGGCTCGCGTCCGAGATTGCCACCCGAAAGGCTATCATGGTACTTTTATTAGAGGTGAAGAAGCAAACCT
TCGTCATTTGAAACAACTACTCTTGCTGCATCCTCGTGTTCAACGGCATAGTACAGCATTTTTCTGAGTACTCCAAAACGGTGAAATCGCGATCTTGTGC
AAGATAGAAGACCTTGcaaagctttttcaaaacattCATTTAAGTACCTTAACAAgtcctgacatgtctcatcGGACTTGTACCTTCTGATAATTTCTCC
GTGCGCTGTAGTTGTTGCTTGCATTCTGATCGTCTGAACATTTttgcattgtcgacatgactcAAGCATGTTTCCGCTTCTAGAATTGTATCGTAGTCTG
AACgtcttgacaacgcatcggctAAGATGTTCGTCTTGCCTAGCTTTTAGTGTTCTACAAAGTTGTCCTCCACAAAAAAGAACCATTGAGCAATTCTCTG
CGATAATTAGAATTTGTTAATGCCGTAAGCAGCGAGGCAAAATCTGTATAGATTGTAAAGCACTCCTCCTCAAGCATGTACACACGGAACTTCAGcaaag
catacttcattgctatAAGCTCTCTGTCACGCACTAAATAGTTCCGTTCCACGGGCCAGAGTTGTCGCTACTGACACGAGACAACTCATTCACGGCCCTt
atcatcgtgttgcatcaacgcaAATCCATTGAATATTCACTTGCTTCGCAAACCACAAGAAAAAGCTGATCGTGTTTG