Description :
From Genome Similarity Track
Location :
Scaffold_5:193029- 194385
Transcript NameFunction/comments
Phyke_g543hypothetical protein PHYSODRAFT_416271
Phyke_g544hypothetical protein PHYSODRAFT_498048

Sequence
1356 bases(100 bases per row)
TAGTGGACCAGATAACCTGCAATTCCTCGAGCTTCATTTTCACGGCTCTGCTAATCTTTTGGAAGGCGATCCTGCTCATGCTGGGTCTCTACTTGTCCTT
CCTCATTCGTAACGTATCAGTGGATTTCCAGGAGTCTCCATGGATTTTCGGCTCGGTGGTCGTGGTTCTTGTGGGCTGCCTCGTCATGATGCCGATGTCA
TACCTCGTAGATATGCCTGCAGCCACGTACTACGTTTTCCTCGCGTGCGCATTGCTCTTTTGTACATTGCTGATCATGGGTCTGATGCTCGGACCGAAGG
TCTTCCGGCTGAAAGAAATTGCTACGGCTAGTTCGGGAAGATCGAAGAGTATAATAAGTAccaggagcagaagcagttTGGTCGGCGCAAAGCCGAGCGC
CGCATACATCACTGAAAGTGACGTCGAACTACCACGCAGACCTTCGCGAAACAAGGTTCATGTCCAGAAGCTGAGCACGAATACTAGCGAACAGTAGCAA
CTGTGAAGTAAATCATGAACAGGTCTCGCGATTCATCATCGCAGCAGATTTTGACCGTATGAAGCAACTTTCATTTGCAATGATGTCCTACTTAGCTAGT
AATGCGTGTCTgacatgttgctgctggttaCTCGACCCTCTCGATACGACACCTCGTTGACCGCAGTCCCCAAACTCTCCTGCATTGCTCCAAAAAGTTG
ATCAGCATATTTCGTGGGTGAAGCCTGAGCGGTGGGATTGGGATTCGTCAAACTGGCTAATTGGTTTGTCACGCGTTGAATAAATCGTTGTGAACTGCTG
CCTGCAACAGTGCGAGTTCGAGCCGGCGTAGAAGACATGTTCGGGGATCGCAATGGTTTCGTGCCCTCAGTCGTCTTCAACCACCGAGCTGTCATAGCTC
TTTGAACCTGCCTTGGATTACGGAGTAAAGGTGTTGGTATCTCTCCGAAATTTGCATTCGCACGCGCATTTGTGTCACCTGAGCCCGGATTCGCGTCGGC
GATATGACCTGAAGTTGATCCTAACTTGGTGAAATTTGGAGAGGACGTGGAGCGGGAGCTCACAAATGTTAATCGTCGGTGATTTATCGTGACCGTCGAG
TTAGCAATGGTACTGGCCGTTTGTGTTATCGATCGTTCGCGTGGTTGTTGGGATTTCTGAGCATTGCTGGAGTCTGCTTTCAGATTGATATCCACACAGA
CTAATTTGTTGTCATACTGAGACGGCGTAAGATGTTTGCTCGGAGTGTAGACAGTCTCCTGTACACCGCGCTGTAGTTCTTGAATCAATGCCAGCGTTTG
GGTTTGTACACTTTCGACCTGCATGATATGTCCCTCACCGTCGGGGGCTGACTTAA