Description :
From Genome Similarity Track
Location :
scaffold_543:1930- 8981
Transcript NameFunction/comments
Pl_103953hypothetical protein PHYSODRAFT_328648
Pl_103954conserved hypothetical protein

Sequence
7051 bases(100 bases per row)
TAGAGATGGTATACGGCCGTCATACCCGGTGTCTGACACTTCGGGGTCCTCGTTATCCCCCTCGCCCTTGCGGAAGAACGCCACCAGATCGGCGAAAACG
TCAAAGCTCACCTGCAGCAGAAAGAGCGATCAGTGGGCAGATCACCAAGCGTAATAGTTATCTGGGGGGTGTATACATTGAACGGGTAGGGGATCTTGAA
TCGTACGAGTGCCTCTGTCAGCTCGCATGTCGTCACGCCAATCCCTAGTACATTGACCACACCCAAACGTGCTAACACCACATTCACGAGCGGTTAGATA
ACTACTCACCAGTATTAGCAAGGCAGATCACACGTACTTTGTGCAACGGACAGTAATCCCCTGCCTTCCATGTCAGCTTGAGAGAATGATGACCAGAGCA
ACTCCATCGGATCATCTACGTCAACAGTATCCCCAACGTCATCATCGCTCATATCCGAGCCGAATTGACCAAACTCATCGTCCGAGTCCTCATCTTCTAA
TGCCTCTTCGCCCTCCTGAACTGTTTCCATACGTTGTTCAGTACTCATTTCTTGAGTTCCCTTCGCTTTCATTTCTCTCGCCTTTTGTCGAGCCATCCTT
TTCCGTGCACGGGTCGCCTTATACGCAGCCAACACTTTCTTTTGCATCGCTATTTCCTGTGCAATGACATTGGGTTGACGAGGGTCGACAACCTTGTAGC
ATTCCTTGTTCGCTTCACGATCTTCTTGCCACTGTTCCCACTTGACCCAACCAGCGTCCACCTCATTCAGTTCATCTGCAGATAGCGGTTGAATTTGTTG
GACACGCCTAACCGTTGTATACTGCTGCTGTACAAATGTGTGCTTTGCCTCAGCAAAGTAACTAGGAAGGTACTTCGCCGCAGTCGCTACGGGTCGCTGA
AGATCCAACATTTCGTCTTGAAGTTTGGGGTCATTAAATAGGGGCTTTGGTCGTCGAGATGCATCACCAGGCGCGCTCAATCTACGAAGGAAAACATGAC
GCCGTGGAGGTGATAACCCCACGTCTGTTAAGTCACTCACTTGGCTCTCCAATGCTGCCTCACCAACGTATTCAGCAATATCTCGTGGTCTCAATATCTC
TACCCCTGTACCATCGCCGTTGAGTACGAAAATGTGGGGTTGGATAGGTTCGTTAATGACTGCTTGTGCAGGGATACTATCCACATCGTATCGGGCAGCT
TCAGTGTCACTTACTACTCCAGCGAGGTCAACAGTAACTGTCGGTCCCGCTTGTTCGTCTGTGCCGCTGAATTTCACGTGAAATTGGTTCTGCTCATTGT
CGCACAGCTGGAATTGGCCGTGACGACAATCGAAGTAATATACACCATTGTGGCTAGTTAAATCTCGATCATCATCATCCTTCGAGTCAAGGTCGCCTCG
ATCTAGTGGCCTGTATTCCACTCTTCCACTGTCCTTTGCTACGATTACTTGCCCACTTGGTTTTCGAGTTGTGATTCGGCCGTTCACCTGTGCCGTAACC
TTCGTATTGTAGCTGATCTCGATACTTGTCCCGTCATAAGCATTCACAACGCTGCGCATACGTAGACCACCCTTCGTAACTGCTACACGTTCTCCTGCAG
CGTGTCGTTGAGCTGTTACGTTGACGTCTACATCGATGCAAGCGTCAGCAAATCCTCGTTTTCTTACAAGTACGTGTGTGCTCTTAGCATTCATATACAT
TCTGGTGCCATCCAGATGATATGTCGCGCGGGCACCATTCGTGAAAGTGACAATAATGACACCGTTGGGGTGTCGCTCGACGAGCGCATTGGTCTCTGGA
TCTACAGTGAGTGTTGTAACCGATGGAGGATGGCCTTCACTGCCATGACTGTGTTTCTTGCAGTCACGAATGACACGAATGATGCCACTTGCTAGCATGA
CTTCTTTCCGCCCACAACGAAGCACTCGTAGCACACTTCCTTTTCCGTAAATCACACGATACTTTTCGCCTTCATTTTCATCTTGCAGTCCATTCAGTGA
TCCTGTATCACTTACCTCGCGGTTCCCATGATTACTGTTGCTTGTAACGACGGACGTGTTAACTCTTTCACTTGAAGTGTGAGCATAGCGCTGAACGATA
GTGCCATCGGAGCATGTGGACACAATGAGACCGTTTGGAAATGAGTTGGTCACTACGATCGTGGAAAACCTGTCGGGCTTTTTTGGAAATTTTCTTCTCC
CCTCGGAGATATAAAGCGTAGACTCGTCTTGAAACGATGCAATGAACGGAATCATGCGTTCCGATTCCTGCATGGATTGTTCTGACCCTTGCTCATTGTA
AATGCTTTCTTTGACTGTGAACTTCCCCACCTCTGAGCGTAATCCAAATGTTTCCCTGTCAAAAATACAGGAGTTAATTTAAATGATACCATAACATCAA
GTAAGAACAGCACGCACCCATGATGGTACACGGTGAGCCATATGACCCTGTGAGGCGTCTGATATAACCGCACCACGCTATGGTCAGCAGGATACATTGA
CCATGTTTGATTCCCCACTAGTGCGAGTTGTCCAGCGGACAATGGGACACATGATCCTGCCGCAGTTTCGGTACGTGGTGTGAGATATTCTTGGGAAGCA
AGTTGTTCACGTTTCCAATATTTGAATGCTGGTCGATGACGCACGTGATCACACGCTGTCCATGACGTTACTTGCATCCGACCAGGTGCGGTCTTCGGAA
GGCACGCTAACAAGAGTGAATCTGTCGGTGCGTAGTAACTTGAGTATATATCGGGCATATTTTGCTGAAGAACCAACGCGATTCGTTGTGGGAGAACGGC
GCGTGTCAAATTTTCAGTAAATGCGCGAGGTTGCAATTTCCCCCGCCAACAGGGTCCTAGCATACCTTCAACTTGTAAGAGCTGTCGTGTTAGATGTACT
AACGAGCAGTTCAAACGTGGTGATGTGTAGAATGTCGCGAGCTCCGTGTTTCGAACACTACGCTCCGATTCAGACAGCTCTGGTACTTTAGGCATCGCTT
TCCGCCCTTCATTACCTACACCCGGTAGATCACTTCGCCTCCACATGACTCTTTCGATGTCGTCAATACGGTGGTTGCCGTGTGGCAGATAACATGGATT
CCCGTCTGCTTCTAATGCTTGATGGTACAGTTGAGCACCCGCCACTCGGCATGCAATTAAATCACTATGCTCGAGAAATTCTTCAAAATAAGATGGATCC
GTTTGGTTACTTTGAGTGGTATAACACAACGTAGGAGATGTCAGAGGAGAACAGACCATCGACACAGCCTCAGTGATGGCAAATAGTACCGTACCGACTC
CAACACTACCGGAAAACACGCCGCTTAGCATCGTTTCATACGTTTTGTAGAGTGCGCCACCCCCATCGTTAACGAAACTAGGAATCGCAGAAAATATTGT
TGAAGCCACCCAGTTCTTAAAGGCAAATTTCTGAGTGGCAATCATCTCCACGGTGGCAACTAGCTCCAGCTCAAGCTCTTCAGATTTTTTAACCACAGCG
TGTTCTGTACTGCAGCAGTCCATGTAGGTGAAAACAAAGTCACTCCATTCGATACCTCCCACCTGAGCAGCCTCATAAAACGCCTTCACAACACCATTCG
CCGTCTGAAACACTGACGACTCCATCACTGATGTCTTCGAATCTCTGCTATCTTCTTTTGAGGAATGGGAATGTGGTAGATTGGTCGAGCTGTTTTTGTT
TCGACTCCGAACTATCAGGTCAGCTAACAGCACCACTCCGTCAATCAGCGGCAACAATGGCAATTTCTCTGGTCCGTCTGTCACTTGTGATGCAGATCCA
ACCTCTCCCAACCGTAATAATGCGTCTATCTCTGGTAATGAAGAAGGGTAGTCCACCAACAGATACACACGTGCAGGCGTCTGTGATCCGTTTTCGCATT
TAATTTCATTCTCCTCTGCTTGAGACTTCACTTGTCCTTCTTCTGCGTCAACTGAACCTGTCTGTAGATGCGCAAAAAACTCTCGTTTGTCCTGACTCAC
GAGTCGCTGGAAGGCCAACGCCAGCAGTGATGGTGTCACTGTAACTGCTTCTTCCTTTTCTTCATCTACCTCTACTCTTGCAGCAGCATCTCCTTCTCCA
GCTTCCTCCACGCTAGCAGCTCCATCCACGCTAGCAGCTCCATCCACGCTAGCAGCTCCATCCAGTGCCTTCTCCTCACGCCGTTTGGTCTCCACCTCCT
CCGCGTGCGTCACCCGCACCTGTTCTAACAGCTCCGCCCGACCCACAAAGCGATACGAGCAGCTCCTAGTCGAACTTGCAAGTGCTGCGTCCCCGCTCAG
TCTATTTAGTAGCTCTCTCTTGGCCTCTAGCTCCTTCTCTGCTGTGCCGCTGGTCAGCGCCACTGTGTGGAAGCTCCAGCAACGCATGGCTCGCGTCTTT
TCAAGGTCAAAGGTAGAAGTTGTCCCACATAATCTGTCTCACAATCACTCTGTCTTCATGAGCATATAAAACCCTTGTTTTTATGTTGAACCGGGGACAT
TTCGGCCTTGGACAGCTGACACTGCACTCAGACGAAGCCCCAGATGCGACTCGTACATTTCGGCTTTGGACAGCTGACACTGCGCTCAGACGAAGCCCCA
GATGCGACTCGTGCGTCTGCTGCTCGCTGTGTGCACGCTCGCCGTGGCGATGGCAGCTGGCCCATGTGACGAAAGGAAGCTGCAGCGAGACGCTGTGATG
CTGCTGGCGGCCCACGTGGATGTGGAACTTGGTGGCGTCGGAGCCGGTAAGCGCGACGTCGTCGGATTCCAATATCTGGTAAGAAATCTCCATAACTTCA
ACAGCAAATCCTAACATATTTATTGTATTTTGCATCACTAGAAACCTGCAGAAGCTCTACTGGCAGCGCAAGCTCTCGCTCACGAGGACTTCAGTCAGGC
AACAGCGCAGGTCCAGCACATCCTGGAGTATCAGAAGCCCGACGGATTATTGCCTCATTTGGTCTACGGCCCGTCCGTGCCGTCCAAATTGCGATGGATA
CCTAGCAATCGAACTTTCCATCCAGGTCCTGCGTTCTGGCAGTCAAAGCATCAGGAAGAGAGTTCGACGTTCTACACCTCAACAATCTCGGCCCCTCCAG
TGGCTGCAGATGTTGCTTGGGAGATCTTCCGCTTGGCACCGTACGACTCAGTGCTTGGTGTGAGGACAACTGCTGTGCAGTTCCTATGCCGCGTCTACGA
GCCACTTAAGAAGCTGCAGAAACACTTATTCTCCACACGCCGCGGTCCCGCTCCCAACAGTTTATTGAGTGCTCGTGTAAGTTCTAGCTGTTGGTATGTC
CCAACACAAGCATTTTCAAGCATGGCTGAAAGTGGTACTAACACATCTTTTCGTGATCGTGGTGTAGCACCCATGGGAGACATTTTCGTCATTATCGCCG
CACTGGAAAGCTTTTCTCGCCGATCTGAAAAATGCACCAGATTACGAGACAGTTGTTGATTCGATCCCTGAGGAAGCCCGAATTCGCTTTGCAATCGGAG
CTAGCACTATTTTTTCAACTGAAGACGCAGTGGAGAACTTATATGAGCCCATGGTGTATCTTGCAGCACAGATTCACCACCCAGGAGACAATGAAATCTC
CCATCGCGAATCAACGATGTTAGAGTCCATCACTTACGCTGCGGATGGAGCTGAGTCTGCTCGATTTGGAGTCGAGGATGTGGAGTTCAATGCACTAATG
CTGCGATCATCGTTGGGACTTGTGAACATTGGTCGAGTGCTCTACGAGCACTCGTCGGTGTGCACAGGGTTCACATTAACTCAAAAAGAGCTTCTGAACG
ATATGGAAGAGCTGCACTCAATGGCCAAAGGGCTGAAAGGGGCTCTCATTGGTACCAACAACTCTCAGGGTTTGTGGAACACATCCACCGATTTTTTTGC
TGATTCTAGCGGATTGTCCTCGAGTTCAGTTCACTCTTTACGTGGATTTCTACCTGAATACGCTGTAGAACTGGATGATGACAAGAAGATGCGATCGATG
AAGCATTTCCTTTCGGAACCTGGGACATTCACATTCTTTTGTACGCGGTTCCCGGGTTCCTTTTTCGCATGTACGGGAGATGATGATTCGTCTAAAGTTG
GCGGTTCGGTGGGTGGCCCCACAGCATCTACGACGTGGATCCTCTACAATTACTTTCTCCAACGAGGGTTTGCTAGGGTACGTTTACTTGCTGTTAATAA
TTGTTGTGATTTGAGATGAAAACCTCGGTGCTAACTCACCGTGAATGATCAGAACAAATTTCCTGGACTGGCCGATTATATCCGCAATAAGACCAGGGAT
ATGATATGCGAGGCAACAGTCACTTCTACTCGATCATCTCTTTCGTGGTTTCCATTCTCACTTATAGCAGAAGAACCCGCACCTACATCTCTATCACTAG
CTTATGATTCTCGTAATGCCGCACCTGTCCAAGTTTTTGACGATAGTTACTTGGGATCAACGCTAGCTGCCGCGGCCCTCCTTAATATTCTGTTACCAGC
AGGTATGTTTATCATACTTGTCTGCAATTGATAATAGCTAACCGGGCCTCCTGTTCTTTGTTTCAACAGTGACCCCACCACCAAGCCCAGACACACCACC
CATTGACCATCGTATTCTCTCTGTTATCATGTGCATCGAGTTAGTAGTTGCATTCGGAGTCGCCATGAGTTGTTTCCTGTTTTCAGTGTATTTTGTGGCG
AACCGGCCACGAGAAACACGGTTATCTCCTGCATCTGCAGCGCGCCGACGATCATCTGCTGGTGCTGCAGGAAAGAATTCTCGAGACAAGTTGGATCGTC
GCAAAGAGGAGTTGGAGGATCGCGGACGCTCAAGTGCCAGCGGATCATCGTGGGCAGACCGATACTCGGAATCGTCTTACAGTGACTACTCACCTCGATC
TGGAAACACACCTTATGAGCTGGAGGAGTCGTTGATTTCGGAGGAGGACGAACATTACGGATCATTTGATGAGGCAGAGCAGCCACAGACTCCGTCCAAT
CCAGCGTGGAAAGCCGCGAAAAAGGCGCTTGCAACTATTAGTCCCTGGTAA