Description :
From Genome Similarity Track
Location :
Scaffold_3452:193- 2509
Sequence
2316 bases(100 bases per row)
CACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTCCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACAC
CAATCCCACGAAAGGATGTGTTGTTGAACAACATGACCGGAAGCGTACTGTACAGTGCGCTGGATCTGGTAGACGGATACTACCAAATCCTGATGCGAGA
GAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGACCCGGCGACGCTCAAT
CGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCA
TGGAGGTGCATCTAGGACACCTCCGTCGCGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCAACATCGACATGTGCGTTTTCGCGTCACAAGAGATT
AAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTAGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCTCAGAAGGATC
TTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCAGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTGAGAAGGATGTTGA
CTGGCGCTGGGAGCAAGAGTACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCTAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTT
AGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAGCGGGTCATCTCGTTCCAGTCCAGGCAGC
TCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAACTTCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGCTCACCTTCTGGGCTCTAGGCC
CTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGCCCTTCTTTGCGGAATAC
AACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCAGACGCCCTCTCTCGGCGTCCTGGCTATGAGTTGGCCCACATCACGCGGGTGATAA
CGGATCTATACGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGTAGAAACGAGCGCGAAGTCCGACTG
GCTCTCGTTGCGACAGCGCTCACGGCTCCAGCGATATGAGCTGAAGGATGGACTCCTCTATTACCGGGTGGGGCCCACGGATCCTCCACAGGTGGTCGTA
CCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTT
AGTCCTTTTGGTGGACCCACCTGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTACCCGCAGGGCACTCTTCGGCTCCAC
TACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTCGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCAGAATTTTGGT
GTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTGCGTCGATGGCGTGTTCCGC
TATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCACA
TGTCCACTGCGGACCATCCGCAGACAGACGGTCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTAC
GTGGCCGACGCAATTTCCAGTTGTTGAGTTTGCGCTCAGCAACGCGGTGCACGCCGTCACAGGGTTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCC
AGAGTGCCTCTCACTCCTTGAGGAGACACTGACTCCTCTATTCTAAGTGGGGAAGAGGCTCGGAAGGCCCTTTCCTCCTAGGTCTCGGATGTGAGACCAG
TTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGA
GTACTTAGACAAACAT