Description :
From Genome Similarity Track
Location :
Scaffold_281:19298- 21534
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_281-snap-gene-0.24Aspartyl protease family A01B

Sequence
2236 bases(100 bases per row)
CTCTGACTTTCTTTACAATCGCTCCAGCATGCGCGTGTCATGCTTCGTGTCTTCGTGGTCATGCGCTGAGCGGTCGAAGATCTCGTCCTCATCGTCATCG
TCATCATCATCATCGTCCGATCCCACTTCGTCCGATCGGAGCTGGTGCTTTCCGTGAGACTTTTTAGAGCGCGTGTGCGGGTCCAATTCCTCTTCGTCGT
CTTCGTCTTCTTCATTTTCTTTGACGCGACTCCAGTTGTGGTCTTTCTTCTTGCTCTTTAGCTTGATCGATGCCGCAACGACAAGGAGGAAGACGGCGAC
AAGAATCGTGCCAACAACCGTTAGCACCATCGGGTGCTCATCCACTTCCGCATTCTTGTGATCAGTGTGCGTTGTACTAGTTTTCGCTGAGCCAGTTGGG
GCTGGCGTTGAGAGCGACTTTGTTGGCTCCGGTGCAGCTCCACCAGATTTTTCAGTGCTGAGCTCGACTGTTTCGACCGACGATGGAGACGGAGTTGGCG
CCAGCGTTGGTTTTTGCGTTGGAGCTTGAGTCAGCTCTGGCGTTGGAGACGGAGTTGGAGATGGCGCTGTTGTTGGTGCACTGGTCGGAGCAAGCGTCGG
AGCAAGAGTGGCTGGTGCAGGTGAAGGCGAAGGCACCGATTTCTCAGTTTCACTCGAAGCAACGACGCCTGGCGCTGGCTTGTCTTGCGGTGTCGTTGAA
GGCGCCGATGTAGCATCGTTCGTTTCCAAGTTTCTGTACGCGCAGTCAGCATCGACGAACCCAACGCGCTTGTTTCCCTGGTCAAAGATCACATCACGAT
ACAGCATGATGTTCGCACCGATCACTGCACGTAAGATGACAACAAACATCAATTATTAGCCATATCAACTCTGCAATTGAGAAACAAACACCACAACAGT
CGGACGTACCTCCGCCCGAGAACTCGGTCAGGAAAATGTTTGCACAGTACTTGTCCTTCTCTTGAATCAGGTACTGGTCTGGCGTCACCTGTAGCACTAG
GTCAGTGCCATCCTCAGCCTCCAAGACGACTTGAATGTTCGGAAGAGTGTCCAGCTGCTCATCAGTGAACCCCGTGCAACCCGATCCAGATGCTTGGTAT
TTCAAACCCGTGACCTTCTCGAACGCGGCTTCAAATGGCTTCTTCATCGAGGTTGGCAAATAGGAGTCTGTCGTGCCACTGTCGACGATAAAGTGGCCGT
GCGTGTAGCTGTTCAGAGGAGCATCGATCGTGACGTTCCCGACTCGAATGTCCTTCACATTTACATTGTAAAAGTCCCTGCAAGAACGAAAAGCAATAGA
AGAATGTGAGTCTCGGAGCTTGAAACCCTGATTGCGCATGGCGCATGGCTCAGTTCAACTCACGTGCGCAACGGATCAGGGCCAAGTTTGGCATACGCGA
TTTCTCCCTTGTGGCGCGCAGTGTCAGGCACGCCCACGGACATCGAGCCACCGCCATCCGCAAAGCACAACGAGAAGAGCTTGTTTGGGATCTTCCTCTC
CTTGTACAGCTTCGCAACGAAGTTCTTGTCATTGTTCGAAAGCCCCATGATACCGTCTGCAACTTGACTGATGAAGAGTCCTATCGGTCACATCAACAGT
TAGCACACGCAAATGATCGAGCAAAGAGAGCAAACATGCGGGGCTTGACTGTGTACCTGTCTCCTTGCTCTGGCAGCCAAACATAAACCGCGTGCCAAAT
TGGTCCCGCATGTGTTCATTCGACGAGCTGTTCTCGCCACCAAGGAACACGATATCGTCCACGACAGTCGCTTCCCAACTGCTTCCTTCCATGTACGCCT
ATTTTTGCATATATCAAGCAGCAAATGAAAGAAAAGCTGTCAATAAGCCAGTCGTAATCGAGCAATAGGCGTGCCGAATGCGGAACGCACCTGGGAGATC
GAGCACATGTTGCTCTGATCAGTGCACTGCTTGCAGCTGAAAAACGGATTCGCGTCAGCACAGGTCACGTGCGTCAGCGTACTCGAGTTCGATACTGCAA
ACGGTTGATCCGTGTGCTCACCACAGCCAGCGCAGCTACATAGAGAACAAGCACAGTACAGAGGACAAACACCGTCAGCCCCAAAGATCGGATACCTCGA
ATCATACAGCCCACGCTAGTCACAATACTGTATTCACGTACCCAGAGCATGGGAACGCCATGAGCGAGCTGCCCGTGTCCGTGATCACCGACGCGCGCTG
CGGTGGCGTTCCAGCGTACACCCACGCGTAGTGGGT