Description :
From Genome Similarity Track
Location :
Scaffold_109:192956- 198937
Transcript NameFunction/comments
Physo_142196hypothetical protein
Physo_142197reverse transcriptase

Sequence
5981 bases(100 bases per row)
CCTCCGCGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTC
GTCGACCCACGTCGTGTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCGCCCCTCGCGCACATTCACGATC
TTCTCGACCTCGAAGACGTCGTCCTCTAGCTCGCACGTGGCTTCCCAGCTATCCTCCGGCAAGAGCTTCTCGTCGAAGTCGAAGCGCTCCTCGGCCAGCA
CCGTCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGTCGTCTC
GAGGCGCACTGCGAACGCGCTGACCAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGATCCAGG
TACAGCCAAACTTGCGAGCCCGTCGCGATCCCATGTCGCGTCGCGTTTTCAGTTTGTCGACGCACTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACG
CTTGTGCCCTTGCCACCTTGTAGTGTCGCTGAATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCAACGTGTTCCCGACGGCCAGCGTCGCTTC
CAGCGTCGACCGAGGATCCCAGCCGTGCACTAAGAAGAACGGGGTTTCATTCCTCGTCCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCG
TATTCGTCCCAGTCGCGTTGGTCGACGTCTGCGATGTACATCTTGATCGCTGTTGTAACCGTCTACACCATCCGTTCTGCAGCACCGTTGGCTTGGGGAC
GATAAGCAAGCGTCGCTCGCTGTCTCTGACCCATGTGTTTGCTGAACGCCTTGAAGACGTCGGACATGAAGCCCGGCTCGCCGTCGTGGCGGATAGCCTC
GCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCACGACGAACCCCGTGAAT
AGGTCGACCCAGACTAACAGCTCTGTGTTCCTTTGTAGGATGCCGGTAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACGAT
GTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGATCCTTTCCCGGTGCATTCGCCGACGTAGCGCTGAACGCTTCTGAAGATCCCTGGCCAATGGAAGTG
GCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAGAGTCTCTGGGATCA
CCAGCTTCATCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTT
TTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACGCGG
ATGCGGTCCAGGCGCAGTCGTTGCACTACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGTCA
CAGCGAGGACTTGTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCACCTGCGCCGCGCGTTTTCGCGTCGCGATTTTCCGCGTCGCGATT
TCCGCGTCGAGGTTTTCCGAGTCGAGGTTTTCCGCGTCGAGATTGTCCGCGTCGGGACTGGCTGGAGACGCCATCTCGGGACTCGATGCCCGTGGTCGGA
TGACTTCTTCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCTTCGGGGCTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGTCCAGCCAGCAT
GTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGACGCGGCCATGCCTGGAGTGCGTTTCGCGTCGTTTGTCGCAGCAGCTTCAGCCCC
GGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATAACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGCTCCTCTAGAAGAG
AACATCCGAGCAGCAGCCCGCGGTATTCGGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGTACGATATCCCAGTTCGGCAGCTGCCA
AATGACGGTACTGTATGCTCCGCCTTCTCGCTTCGCCTTGGCCGATCCGTCAAAGCTCAGAACGTGCAAGACCTCGTCGCGCGCCACGTCGGGGACTGGA
ATGACTACAATCCTGGACGCCCGTCTCCGTGGGGCGATCTCTTCTAGCGCCGCGTCGACGAAGGCTCGCGGGGTAATGCTCGCGGCCAGCGCGCCGAGGA
GTTCTTCTTCTCCTTTCATGGATCGGCAGATTTCCAACTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGTCGCCCCTGTAGTCCTTTGGACCGGAA
CAACCAGGCGAGTGACGTGTCAAGACGCGGACCGGTCTCCCTGCTAGCATCGTGTAGCACTCGTTTAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGA
CGATGTCGTAGTTCAGCTCGTTGGGCTTCAACGTACGACTGGTGAACTTCACAAGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTGAGATGGC
CCAGTCGCTGGCGTACACGATCACGACGGATTCTCGGTTCGCGCCGAAGTGCTTCAACATTGGGGCCTCGGCGAGTTTTGCCTTGAGCGCGTCGAAGGCG
CGCGTCGCGTGCGTCCACTTCTCATGTCCGCGGACTTCTGGATGCGTAACGTACTCGCTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCATACA
CCGCAAAGTCTGCAATGAACCGGTGGTAGTAATTGAGGCTACCCAAGAACGATTGCAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTC
CAGATTCTTCGGCTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGAC
AAGTGCCACTGCTCGCAGACATCCAGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTGCCCCCGATGAGGATGTCGTCGATGTACGACCTCC
GTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAGAGCGC
GTTGTCGATCAAGCGTTGGTAAATCTGCGGTGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGGTG
AGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGA
CGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTTATGATCACGAC
AATGGGCGACGCCCACGGCGACGTCGACTTCTGGATCATCCTCGCGCTCAACAGCCCTTTGATCAAGTCGGCGACCTTCTCTCGAAACTGCGGCGGGATT
TTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACC
ACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCGGCTTTCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGAT
CTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGTCGGACCCCTCGTGGATGAGGACCGCGTCG
TCTTCCTCCTGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTTTTGGCTCGGCGAGTTCCGACTTCGGCGATTCTT
CCATCGCAGCGCTTCCAGCCACATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCC
TTCGGCGCTTCCGCGACAGCCGCCAACACTGGGTTCACGGCGCGTCGCGTCCCGAGTTGTCCCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATG
AGAAGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGCGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCG
GGTGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTGCATGCGCGTCGAGGGTTATCGCTGCGTCT
CCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGCGCGT
TTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTGCATCCGTGCGCCGTATAGCGGTCT
TCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCATCCGCAGTGTCGACGCGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGG
ATTGCGTGTTGGCCGACCAAATCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAAT
ATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGC
ACCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGATTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCG
CGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCACCGAGATTCGCGGCGCGCGCT
CTTGCGTGGTACGTTCCGGGTTGGATTCCCATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTTCTTGGTCACATATGCATA
GACGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTAT
TCGGGTCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCCATTGGGCATTCTCCGGCTTCGTGCACGTCACCGCGGGATCCTTGCACACCCTCAAGCAT
CGCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGACATGGCGACGTGAACCACAGTGGCGGCACCGCGGGC
GGTCGCGTCCCGAGTCGTCGGGATCGAAGTTACGACGCGCCGGCTCTTCCGGCGGGGCCTGTCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCGCCTC
GTCTTGGTCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGCATGCACGGCGCGCGCCGGCTGA
GTCGGCGGGGTCGGCGCCTTTTGGAGGAACTTGTTCGAGCCGAAGAGAGTCTTTTTCTGGTGAGCCAATCCACGTTGTCGG