Description :
From Genome Similarity Track
Location :
Scaffold_248:19295- 20987
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_248-snap-gene-0.15Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_248-snap-gene-0.23Dynein light chain type 1
Pytap_DAOMBR444maker-pag1_scaffold_248-snap-gene-0.24Conserved gene of unknown function

Sequence
1692 bases(100 bases per row)
TCAGCCGTGGCGGAAGACCAAGAAGCCGATCTGGCCGAGGAAGAAGTAGAGCATCCTGCGATCACCACACGAGCTTTCGTCAGTCTCTCTGGTCGCTGAT
CAACTGTCGCCGACTGGAGGCACTACTCACTTCTTGACTTCGTGCGAGACGAACGACCCAAACGACTTGCCCACGATCACGTGCCACGCCCCAGGCTGCG
TCTCCTCGACCTCTttCTTGATCTGTTGTGCGACTTCTGTTAAGTGGTTCTTCTCGCCCTTGTACAGGGCCTTGAGAGCGTTGGTGGCGCTCGCGATGAT
CAGTTCTTCGAGTTCCTTGGGCGCATCCTGGTACACGATCCGCAGAGAGCCGACGGAGACGTCATCTTTCTTCTGGGCCTTGGACATGGCGGATTTGTTA
TACAGTTGCGATATCCACACGAGAAGACGCGtCTTTTCAGTCACCCACAGGGTCCGAACACAGTCATGAGCTCACCCCATGGGAGCAAGGACGCCCTCGT
GGACGCGTACGTGCGTCACACAGTGCGAAACGTGCTCTTCTCGGAGCTTAGCTCAAGACAACGCGACGGAAGATCGCCAGCTCGACCTCAACaGCGGCAC
AAGACGACGTCAGCAGATGAGCTGCCTTTtCAAGTCGGCCAACATCACGCACGCGTgTTGGGGTATGCGAGCTGGAGCGACGAGCAACTGAACGAGGAGA
AGAAGAAGCTGACGCGGTATCTCAAGACGCACCGGCgAGACCTGGTCAAGCAGGAGCAAACACCTGAAGACGACCACGAGAAGCAGCCTACGACCGGTAC
TGTCGTGCTCGCTATGGAAGCGCTCGCGTTGCTCCAGCTTTTCTtACGCGAACGTGCACCACCGAATGACGAGAAGAAGGAGTCTCGACGTCTCCTACAT
GCGCAGCTGGCGCTGTTCGCAGTCTACTTCGAGAAGGCAAATGGGCgAGGCATCGAGCACGAGACTGACGTCGTCCACGTGCGCTCGGCGTACGAGGCGA
TGCTACAGACACAGCCGAATGAATACACATGAGGTGCGAAGGATGTGTGGTGTAcATTTGAATTAGACGTAGGTGGGGATGAGGTCGGTCTTCTTGGAGT
CCAGACATGGGACACTGAGCCAGGCGAAGTAGAAGGCCGCACCACCcAGCACGTGCATGCaGCCcTtGAGGAAgCCGATGCTCCACTGATCGCCTGAGCC
GgAAAaGTAGAtGGgAATGCTGCcGACCAGGGCGgCAaGAACGAGGAAGATGAGCGAGAACCTGGCGTtcTCCTTCTGCAGGGGGgCgATGGACTTGTCT
GTCGACAGCACACGGCGGTAGACAACGCCCAGTACGTAGGAGACCACGAGCAGCACCTCGTACACAGTCGTATCCCATCCGtCCTTCGACTTCATGAGCC
ACGCGAATGCAAATGCGACGTAGCGCAACACGATATTGGTATTCTCGTCGCGGAAGCCCATGAGATGGACGCAGAGCACAAGGAaGTAAGCGACCGAGAG
CACATCCGAGATGAAATGCCACTGCAGCTCCTTGAGGAAGAGCGACGCGTGGAAAGCCTCCGCCACGTTGAATAGGAACGAGATGCACAActGGAAGACG
CCGAGGAAGAGCTcAAAGTGCCGATGGTTCTTGCGCATCACATTCAATGCCGGGATCATGGCGGCGTCGGTCAGCGCCAGACAGCAAAAGCG