Description :
From Genome Similarity Track
Location :
Scaffold_650:19294- 21965
Sequence
2671 bases(100 bases per row)
TGGATCTTCGAAAGGGCGTGGCAATGGGTGGTTCTCTGTCCGCTCCCTCCTCAGCGCTTCACTCATTTCGGAAAGATTCACTCCAGACTCACAGCCGATG
AAGTGCGCGAAGATTGACTGCAATTGGGGAGACGTCCGGAGACTTCTCCTTGCTGTGTCTGCGGCCGCCAAGTGCACCAtttgtgcagcaacgagctctg
CACCAAAGCTGAGCTTTCTAAAAGGTAATCCAGCAATTTGTACCCGTTTGATCCCTCTCGTCTCGAACTGACAGCACATATTGGCACCACAAGTGCGCAG
GGAGTTCTTCAACGCTGAGAGCGGCTCCCAGGAGTTCACACCGAGTAGCACTTCCGGGATATCACTTTCGAGCGACACGCTGATAGACCTTGCGCAAAAC
GAGGAGACGGAAACAGGCACCACGAACAGTATTCCCGGTCACATTGTCCACAGCCCTCAAAAAAATTCGACCGACAAGGATTGGGAGTTGATACATCGCG
TGGACGATCCTGTCACGTATAGGGGCAAGTCATTCACCCACATTTGTCTGCTGTGTCTGGAGACGAAGGGCTAGAAAGAGTACTGTGTCGTGCTAGGCAC
ACATCAAACGCCAAAGCGCATGTGCTTGCTGCTCATAAGGAACATACGTTGGCtgccaaggagcagcagcatcggctTAAGCGTACCGATCGCTACACCG
TGAAGGTGGCCACGAAACGAAAAGTGGAGAGCCCTGAAACTAATGCTGAGCCAGGCGCAGACAGCAAGCAGCCAGCGAAACGGCAGAAACCTTGGTGGAA
GGCCCCTGCTAGCCACGATCAAATCACGGGTCATATTGCGCAGTGGCTAATTCGTGATGGTGCGTGCCTCAGTTGCTGTTATCGTTGTTTCTTTGGTTTA
ACGTACTTGTTTGGTGTAACCAGGGCTGCCCTACAACATGGTGACGACGCCAGCTTTTCGTGGTTTCCTAGCCGGTGTTACTGGGGACGCTAATGTTACC
ATACCATCCAGCAAAACCTACAATGATATCCTCGACAACCACTACGACAAATCCAAGAATGGCGCCTCGGAACTGTTCGGTCTTCGCTCCCACCGGAGGG
TTCGATCCATATTTCCCCGCATACTTGGCGAGTATTTCGTTAAGATCATCAGTGAGCTCCTGCCACACCACTGCTGGGGAAGCAGAGGAGTTCAATGAGC
TACACGGAACAGGGTTCATGACCATGGAGCACGACTTATGGACCAACAGCTCCAAGAGTTGCATCGTTGGCGTTTCCTGTAGCTTTATTGACCGGCACTG
GCGACCAAGACGCCTGACACTCCTGGCACAAGTAAAAAATGATGTACATGACTCTGGGGAGGTTGCTgaggtgctggaagagcagctgaAGGCCCGTTAT
GGTTTGGATGTGAATCAAATGGATCGTTTTACGATCTCTGacacagctgcagccgctcggAAAGTTTCAAGGCAGTTTGACTCGACTCTGCAGACAGAAT
GTACAATACACGCCCTCAACCTCTGTATTGGTTACGGAATTGGGCTAAAGGAGAATGTGTGCAACGTTTACGTCAAGGACCCAAAGACGGAAGCGTTCAT
CAAGAAGCGGCTCGTAGTCACCGATGGTGGAGCGTTCCCGGAAGGTAGCGCGGTGATTCGAAAGTTGCGTGCTCTGAACAATTTCTTTGCCTCGAGCAGG
TCGCTTGAGCGTATTGCCCGCCTCACCGAAGTTCAAAAGTTTCACAAACTACCTCAGCTGGCAGTTCTGATTGACGTCGACGTCCGCGTGGCTTCGACAA
TCAAACTCTTCCGTCGTTCTATCATCAATTATCCGGCTTTCCTGTCGTTCTTTCAGAACGCGAGCGTGGCAAAAGACACAAACGAAGTCTTCAACTGTAT
TTCGCTCTCCGATTGGGAGTTGGTGCCTCAAATAGAGACAGCAATGGAGCGAGTGGCGGAGCTAGCCCTGGTTGAATCTCAGTCAGCGACTATTCTCCCG
TCTACGATGtatgtgctgctgcgcgtggcaTCCGCCAAAATGAATTTGTACAAGTTTTCTGCGTACTGTTTGAACGGAGCTGGTGACCCGACCACCAACG
AGAAAAACTTTCCACGGGTCTAGCTAAAGCTGACTGACCTGTCGGAACTGACCCAGCGCTGTATTAAGCGTACACTGTACCAGATCGATGAGCGCCTACC
GAAGCCGTCAATACAAATGGGATGGCCCTGCTTTTTGATCCGCGGACCAAGGCAGCAGCCAAAAATTTCCTGCGCATCCCCGACCACCCGAAGACAGCAA
CCGACAAGCTTTTAGATGAAACAACAGCACTGATGCCCATCGAGCATATAGTCTTCTACACAGCACTCTATGCGAATGCAGGTCCAAGAGGTGATacagc
tgcttctgcttcgagtTCACCACATGGGGACGGCAACTTGGCCAGGACACGTACCATCGATTGCCAAACTAGCACACGTCTGGCTGGGACGGGGTTGCTC
GACGACGTTTCAAGAACGGGTGTTGTCCACAGGCTCATTTTTAATGAGCCCACAGCGCACAGGGACGGATAACGAGCGAGACCAGCGGCAACTGGTACTG
TGTCACAATCGTCTTGAAATCAGGCGAATGGAGGAAAGAAAGAGAGAGCTGCGTCAAGTGCCGATGTAGCC