Description :
From Genome Similarity Track
Location :
Scaffold_50:192858- 195235
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15575heat shock protein 101

Sequence
2377 bases(100 bases per row)
GAAAGACCAACACTCTGAGCATGCTAGCGCTATCCCGCGCCGTAGTGGGTCGCCACGTGCCGCTGCGCACGCCATCTCCCGCTCTGTATCTCGCACGCCG
CGGCTTGGCCTCTATGGGTCAGCCACAGACGTGGATCAACCCGCAGAACGTGCCGCAGGGGAGAGTCTCAGGAAATACGGTCGCGATCTGACAGAAATCG
CCAAGGCCGGCAACTTGGACCCTGTGATTGGCCGCGAGGACTCAATCCGCCGCGCCACGCAGATCTTATCGCGTCGCACCAAGAACAACCCGATTCTGAT
CGGAGAGCCGGGCGTAGGCAAGACGGCAGTGGCCGAGGGCCTCGCACAGCGCATCGCACTGGGCGAAGTGCCCGACAGCCTCAAGGACAAGAAAGTCGTG
GCTCTAGACTTGGCCGCGCTCGTGGCTGGTGCCAAATTCCGAGGCGAGTTCGAAGAGCGACTCAAAGCCGTGTTGAAAGACGTGGACGAGAGTGATGGTA
ACGTGATTTTATTCATCGACGAGCTGCACACTCTGGTAGGAGCTGGAGGCAACGAAGGATCCACCGACGCCGCCAATATGCTGAAGCCAGCGCTAGCCAG
AGGCGCGCTGCACTGTATGGGCGCCACCACGTTGGACGAGTACAGGAAATACATTGAAAAAGACGCCGCGCTGGCCAGAAGGTTCCAGCCAGTGTTAATC
TCCGAGCCCAGTGTGGAAGACACGATCACGATTCTGCGTGGACTGAAGGAGAAGTACGAAGTGCATCACGGCGTGAGAATCGCCGACAGCGCGCTCGTGG
CGGCTGCTACGTTGGCGAACAGATACCTGACGGAGAGGAAGATGCCGGATAAGGCCATTGACTTGATGGACGAGGCGGCGTCGAGACTGCGACTGCAACA
GGAGAGCAAACCGGAGCCCATTGAGAAGCTGGACCGTGAGATTATCCTGCGTCGTATCGAGATTGAAGCTCTGCGGAAAGAGACCGACGCGGCGTCGAAG
AAGCGCATGGCTGCGTTGGAAGAAGAAGTGAAGAAGGCGACGCAGGAATTGAACGAGTTGATGGACGAGTGGAACGCGGAGAAACACAAACTGGAGGAGA
TGCAGGACGCCAAGCGCAAGCTGGAAGAAGCTCGACGGGACTTGGTAGCAGCGCAGAATGCTGGTAATTACTCCAAGGCAGGAGAGTTGATGCACTCTGT
GATCCCCAAGCTGGAAGCCGAGGTGGCTCATGACGAGCAAGAGGAAGAGGAGAGCAAGAAGTCGGGAAAGAGCAGAACTTCACTCGGAGATGCTGTCACA
GCGGACCACGTAGCGGAAGTTGTGGCTCAGACGACGGGAATTCCAGCGTCGACACTGATGGAAGGAGAAAAGCAGCGCTTACTGAAGATGGAAGATCATC
TCAACCAGCATGTGATTGGTCAGGAAGAAGCTGTCAAGGCTGTGAGCAACTGTGTGCGTCTCGCTCGAGCTGGACTGCACGCACACAACCGTCCATTGGG
AGTGTTTATGTTCCTGGGTCCTACAGGCGTTGGCAAGACGGAATTGACCAAGTCTTTGTCGGAATTTCTCTTCCAGACGCCACAGGCTTTGACTCGCATC
GACATGTCCGAGTACATGGAGAAATTCAACGTCAGTCGTCTCGTGGGCGCTGCGCCAGGCTACATCGGCTTCGAGGAAGGCGGTCAATTGACGGAAGCTG
TGCGGCGCAGACCGTACCAAGTGGTTTTGTTCGATGAGTTCGAGAAGGCTCACCACGACGTGAGCAACATTCTGCTCCAAGTACTGGACGAAGGTCGGCT
GACGGACTCACAAGGTCGTCTCGTGGACTTCCGCAACACGGTGATCATCCTCACGAGCAATCTGGGCTCGGAGATCCTCGCTGGACTACCTGAAGGCGCC
CCTAGCTCCATGGCTGAGGCTGATGTTCTGAACGTTGTACGCTCCCACTACGCTCCGGAGTTTTTGAACCGTATTGACGAACTGGTTCTGTTTAACCGGT
TGAAGCGCGAGGATATTCGTGCAATTGCGGATCTGCAACTACGTCAAGTGGACCAACTGCTGGAGGAGAAGGAACTGACGATGAAGGTCGATCCGGAAGC
GGAGGACTGGCTGGCTGAAGCTGGATACAGTCCACTATACGGTGCACGTCCATTGAAAAGACTGATTCAACAGTATCTGCTGAATCCCATGGCGGTCAAG
CTGCTGGAAGGCGCTGCTGGTCCCGGTCAAGTCTTGCATGTCAAGGCGAACCCCAAGTACGAAGAGGAACTGGTAAAAGACCCAAAAACAGCCACTCCGC
TGCTCATTTCTGTTGACTAACGACAAAAAAGCTGTTGGAGCGCAACTCATTGCCAATTATTGTTCTTAATTAAAATA