Description :
From Genome Similarity Track
Location :
Scaffold_156:19284- 20374
Sequence
1090 bases(100 bases per row)
TGCCTGGAAAGGTCCCTTGGCTGTTGTCTTGCATGAAAGCATGGAAGGATTATTTCACGCAGTTTATTCATCGTGGCTTAGCACCGCTTTGGTCGGTACA
GTCAGTGCTCTCTACTATCGGAGCGTCTGTGGGCGACGCCGCAACGGCATATTTAAGTGTGGCGCTGCCTTGATCGGGCTTCAGGCTCGAGTGTTGACCA
CGATGGCATCATTCTCAGCGGCTGCGGTGTCACCTTCGTTGGTTGCATCGAGTGGTGAGTCGGAGGCCGGCGCCACTAGTAGAGCCAGGTTGGGATCCGT
GCGATCTTGGGAAGGGAGTGTCGTTGAGCGATTGAGGCCAGCAATACGGGTGGCTGCACAGATTCGACCTCAGTGTAGAGTTCGAGAGTTGCCTAGCTTG
GAGGCGGCTCTTCCTCAGTCACAACCACCATCCGTTCGAGAGGTGGTGCATGGTGCGTTGGCACAGGCTTCCGTTCCGGCCGTACTGCGGAAGAATTTGG
TTACTGGCTCAGTCAAACGCCTGCTCGTAAACACCAATTTTTGAATGTAAAACCCAAAGTTTCGAGTGTAAAAACCAATTTTGAATGTAAAAGCTACCAT
CTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTCGTAAACACCAAATTTTGAATGTAAACGCCAACATCTCAAGCGTAAGAATTAAACTGGTGATGAATTTCGCCTGTGGCGACACGATGTACCA
ATTTACTCGAATTGGAACGTCCCGTCGACCTGCTGCTAGGCGAACGGATCGCTCCCAGTCGGCGTCACGGGCTCCTCTTCGCTGCTCTCGTTCGGTGTTT
CGATCCGGCCGGCGATTGACTCAGGTAGCGGTGTCTCGGTATGAAGAAGCTCGTCAGCGTCGAGAACCAAAGCATTGCTACTGGCATTGGACCGTGTCGA
GACCATCGGTGACGCGTCGTCAGTACGCAGCTCGACGGCGGCTGCCTCGCTGCAGACTGCAGCGACTTCAGGAGGGTCATCCTTGGTTGT