Description :
From Genome Similarity Track
Location :
Scaffold_4:1928023- 1938366
Transcript NameFunction/comments
Phyin_T30-4PITG_03486Putative uncharacterized protein
Phyin_T30-4PITG_03487Putative uncharacterized protein
Phyin_T30-4PITG_03488Dynein heavy chain

Sequence
10343 bases(100 bases per row)
ACGTGGCCCCTCTCTTCGCTGACCTGCTCAACCGCGGCCTCGACGTCGAGAAGTTCCTCGCTGGCCCCTCGGCTGGTACGACCATCACTCTTCAATTGTC
ACTTTTTTTTAAAATGCAGTAAACACTGACAATGTTGTTTCTGCTATAGGTGCTGCACCCGCTGCTGGCGCTGCCGCTGGCGGTGCTGCCCCCGCCAAGA
CGGAAGAGAAGGCCGTTGAAGAGGAGGAGGAAGTCGACATGGGCGGCGGCATGGACATGTTCGGCGGAGACGAGGACTACTAAGTGTCTGCTGTTTTCCC
GCCCGTTGGGAGTCGATCTAAGCGTTCACAAAAGGAGCGTGGGATGGCTGTTTAGGTCTCTTTGATAGTGTATTGACGTCCCCGCCTCTCTTCTTCCTCG
TGTAACGCGAATAAATCGACACAGAACTACTCCAACACTCTCGTCTATCGATGCAGCACACGCAGACGCAGATCGCTGTGCAGACGCTTGTCCATCTCGG
CGTATTTGTGCAGAGCCGTCTCCTCATGACTAGCTAGTCGCTGCTCCAGTATCTGGATGCGGAACATGGTCTCGCTGCAGAAGCGCTCGAACTCGTCGTC
CGTTCCCTGGTCGTGTTCTCGTTGGCTACGCTGGAATGCAGCTTGGCGCTTGGCCAATAGCGCATTCTCCTTGTCCAGCCGTCCTTGGATAATGTTGGCA
CGCTCCAGTAGACGCTCTTTCAGGTTCCGCAGACACAGATCCCGCACAGTTTGGGCGTCTTCTTTGGATAGATTTCCTCCTGTTGAATGGACACTTTGCA
GGAACGGACTGAGATAGTCCACCTCGTTCTTTGCCTGTAAAAAGTCGGTCAAAAGGAAAGGTTATCGATTTAATCCTGACCGTATCCAGGTGACGTACGT
TTTTGTCCAGCTCCTTGGTGTCTTCTTTGTCTTTGGCTTGTGTCTCGTCGTCATTACCGTCGAAGAAACTCGTTTCCAATGCAATTGCCATTTCCTCTCG
CTTTCGGATTTTTAGAATATCTTGTGTCTCGATATCAGAGTGGCGAACTGCGCTGTAACAATCTTTCTCCATCTGATGCAACAAACAACATGAGAAAAAA
AATGTTCACATAAATCTGCTTTTTACTGTTTGAAAGTTACGGTACCTGTAGAGACGCTTTGAGCTCGTTTTCAAGCACCGAAAGCTTTGGCTTTTTCGCG
TTTGGATCCGCCATCACGACTTCCACTGGGATGTTGGGGGTCTTGAAATACACACGTGACCCCGCTGTAATCTTACCTGTTGCATAGTGGAAGTAGACTC
GGATAGAGCCTTCGTGAACATTGTACGCCCGCTTGCGCTGATCGTCATCAGCCGCAAGCGCAGGGTTTCGCGCAAATTTCTCCTTCATCTTCTTAATGGC
AGTTTCACCACCAGGGCCACCAGGTAAAATATACGGATTCTTCGCATCCACTTCGTCCTTGTCCGTAGCGAGTGTCACGGATCGAAAGACGAGGAAATCG
TCACGGCCGTCGAAGCGCTCTAAAACACGATCCTGAATCTCCTCTTCACGTGTTACCAGACCGTCAGGCCGAGCACTTGTGTAGAATTGAAACTCACGAC
GGTACCCGATCCACTCCGTGCGCGATTTCAGAGCCTCAGGGATTCTCCCTGGAGTGAAGCGCTCTTCGAATTTGCCTTCGAATGGAAAACGGAGTCGAGA
CTCGAGTCTGTCCTTCCTGTTTTTAAAGTATTCACGAATCTCGACGGGCAATGTACACCCAACATCACGGAAAAGCGTAACTCGTGCAATCAAGCCCTGC
TCGTGCGTGTTCTCGGCAAATTCTTCGACTTTAGCTCGATGGTAGAGCGTCACATGCTGGCAGTCCTTGACGAACCGTTTCTTGTAGGTTGCACGGTCAA
TGTGAAGCTTGGTCACCCACGACGGAGGGATATCGAGAATTAAATCGTCGTCAGCAGCGTCCTGTCCATGATGATCGTCACCTTCGGTACTCAACATCTT
TAGATCGTTGGATAGATCGCCACCCCCCTTTGCACCTTGATCAGCCTCTTTCGCTGATTTCCGCTCTGCAGCAGACAGGAAAACGTACTCCCAGTCGGTT
GGATTGGACAAATCGAACAGCGTAAGATGCACAGGTTGCTGTTGCATGTTGACCCAGTAGTTTTCATGATTCCAAACGCTCTCGATGCACATGTAGGGAG
AATCTATCAGCGAGTAGCTCCGTCCAGTCGACGGTTCGAGGTAAAAGTGATACGATACTTCCCGTTTACCTGCTCGAATGAGGACCCACGCATGTGCACG
CTTCCCCTCTAGCGGATCTTCGTCGTCTTCATTGTCGTTATAGCCAAAATCCAAGACTCGACGTGTCTTCTCCTGTCGTTCTTTCTCTTCCAGCTCCTGC
TTTTCAAGGTATTTACTCGTGAAGGTGGTGCGGCTCACCAGTTTCACGTCACCGTTGGTTTTAGTATCTGTTACCGCCTTAGAAGAATCGGCGGCCAGTT
CGCGTTCGTGGGCCTTGATCAGCTCCTCCTCGACTGGTAAAACTGGCAATGGCGCTTTGCTTTGATCCAGAAGACACAGCCACTTGGGTGCAGTACCGTT
CACGACATAAGCGTCATATCCTGCACCAATCAAGAACGATACCAGAAGCGTAGCCAAGTCAAAGCTGTCTCCTGCCTTCCACTTGAGCGTGAATGACGGT
GACGGTAGACACACTGGTGGGATCGTCGGGTTTGCTAAGGGTTCGTACTCGACAACCCTCGCCAAAAAGCGAGATAAAGTATGACAGTCATACAGATCAC
GATACGGTAGTAACGTCGGTCGGATCGTCGTGCAAACGAACTTTGGCACCCCTTTCTCGTTCGGAGGATGTAGATACAGCGGTCGTCGCGTTGGGAACAT
GCGTTCGAATTGCCGCTGGAAACCGGCAATGTACTCGAGACAAAGCTGCTCCTTTGGGGTGTTGCTACCGTACGACGGCAACTCGACCGCGTCCACTGTG
TCATCCACGAGACGTCGCTGTTTGGTACTAACCACGCCTGCCATGGTGAATTGTTTTGCTGCAATCGCTGCGTCCTCGTCGGACTGCGTCACGACGTCTT
GGTGTACATCCAAGTTGCTGTCAGCGTCATCATTGCCGTCTTTGGCATCGGCTTTCATATCCAGCACCATGAGAGCCACGAGAGATCGTAAACAGCAATG
GTTTCCGAGGATATGTCTTCGCAATTAGCCTGCGTCCCTTCCAAAGTAAAACGGAGGTGGCTAGTCGTCAGTTTGGTCCAGGATCAAGCACATGAAAGGC
CAAGCGGACTTGTCGTCGCAGAATGTGGCGCGAGGCTCGCCCAAGCGAAGCCCCGTGCGTCTGGCACGATTAAAAATGCTTCAATGCGCCATCAACACTC
GCAACTGCGACGTCCGAGACCTTACGGATCAAGTTCCAAGTGCACGATCCGAACGACGAATCAATCGACTCGAAGGACCACAGGACGAGATGTTAGCGAC
TATGGGGCCATTGGGAGGACTCATGGGTCCTGAATTAAATGGCACAGAACCGCCACGAAAGCAGAGGAAGTTGTTGCAGGCGTCATATCGACCAGGAGAG
AAGGTGACGGCAAGTGTCGAAGACAGAGGATACTATCGACTAAGCGACCGCATTGGAGCGTATTATACGCAATCAGCTCGAACTCTTACCATCGAGAGGA
TATCGAGCTTCACGAAACGAGAAGCTCACATGCCCGTAAGCTTAACCAAGCCAGTGCGTTTACCGTCATCAAGACCCATGGCAATGTGTCCTGCACTCAC
TTCTCAAACCAAATCCCAATCATCATTGGGCTTAAAACAAGAAGAAGCTCCACTTTCACCTCGAGAGGAACGACCAGACAACACTGAATACGACCAAGCT
GATCAGCTAAGTGTATATATCGACGGGTCCAGGGCATACGCACGTCATGTGGAAAACAGTCAAGGTATTTTTCGATCACCGTCTCCTACGAAACCTTCGC
TCCGAAGTCCCAAGTCACGATCAAAGTTTTCTCTAGATGCTCACGAGAAGACGAGTAGAACACTGCTGGAACCTGTGCAGGCTACACCTCGCACGTTTGA
ACTAGAGAAACGACGATACGTGAAAACGATGGAAGCGTACTGGAAGCAAGTGGACTTGTATCTCGCTGCAGCAAGGACGGTACCGATGGCAACTGAACGT
CCTCATCGCATTCTTCGACGCTTGCAAGTCCCCCCTCCAACTGGACTGGATACTCAGGGCTTACAGGCATTCGATGAGCGAAGTGAAGCTTTGATCGCCG
ATATTTTCCAGGAAGTCTATGCAGATTACTATGAGACCGTGGCGCGTTGTATGTTGTCGTACGATCTTCTTGATGCGAACACGTGCTTGGCCATGAACAT
CTACCCTCCGTTCTTACAGGCGGAGCAGAAATGGTGGACCGATGCGACGTACCAGTCTGATGCGTGGCGTGTTCTTCGCCGAACTGGAGTAAGCAGCGAC
CGAGCGGAAGTGGCACGAAGTCGAATCCAACAGAACTTGTTTGCTATCAACCCAGTGACGTTCGCTCTTCAAGACCAGTGGGTCATGGAGACGCCTCCAC
CGGAGTGGGAGATGTCGCCAAACGGAGGAGGGGCGACTTATTCGACCATTCTATTCGTCGACCTTCACAGTCGCGAATTTCGAGCGACGTTGCCAAAAAC
TGTGGATCATTTCGTAGATGCCATCTCAAAACGTGCCGGTCTTGTCAAGGATTGCTTGAAAACGTGCTGGGTTACAGCAGCAGCGAAGAGAGTGAACGAG
TGTACGCTTCAACTGCACTACTACAGCGTTCGCAGTGGCACAAACGCAGCAGAAAACACGGTACTCCCTGGACTGATAGGAGCTGTGAAAGCCGCTCCGA
TTACCCGTGCGTCACCGTCTAAATCCAAGACCGATGCATCGCGAGACCATGAGAGTCACAACAAGCTTTTACGAAACCGACTGGACTTTGAAGGACTGAC
CCAGAAACCTCAAGCTAATCGGCAGAATAGTCCAAATCTTAGCGCAGAAGACACTGAAGCGACCCAGTACCAGAACTTCTCTGGTGTCCTGGATGCAGCG
GCAGTTCTGATGGCGAGGAATTTGAGAGAGTCGGTGGAGACTTCAGTAAACGCGTTCGTTGGCTTCATTCGCCAATTCTCGAGTCCGACGTTTAATGGCG
AGTCTGCACTGCTTCTTGCGGTGGACTGCACTATCACAAGCGATGGGACCATTCGAACACAGGACGGCTTCTTCATTGAGCCTTCTCCTAGTGCTTTACG
AGAGAAAGTCGCGTCCTGCATCGATATCATCGTCGAGTCATCCCATGGTTTCCCTCGAATCGACGGCCAGACGAAAATTCCTCCCAAGCTTCGTAGCTCG
GCTACGCTCGGACCCAGCACAATGATATTGGATGATACGTTCGTAGTAAAGGCGAAGAACACGTTGGCGGAGCTTATAGCTGAGCATATGCACGATCCGA
CCGAGATACTAGCTCTCTTCCAGCCGTACGACCACCTCGTAAATGGAGAATATGAGGCCAAACTCGAGGCGCTGATAGAATCAAGCGACAAGCTACTGCA
TGGCCCGGAGCCAGCAACTGCCAATGACATCCTCAGTGGATACTGGGGCGAGCTTAACGAGCTAAAACACTTGGAAACCCAAGTCAAGGACGATATCTTC
GACAAATACAGCTTCAAGCTCTTAGCAATCTCCTGCACTGACGTGAAAGTCAAGCTCGTCAACAAGATCAAATCTCACGCAAACAAAGTTCTGAGTAAAG
TGTCGGCTGACAACACGAGGCAGATGAGCTCGATGATTGCAGAATACGAGCAAATTGGCGCAAAACTGGTCACGGAGCCGTTAGATTCGTTCGAACTCAA
AGCGCTGGACAAGTTCTACGTCACCAGCATCGAGCTCATTGATGCTTTAAACATTAAACTCTTCGAAGACGTGTATCGCTGTATCCAATTCCTAAAGGAC
TTTGACTTTCAGATGTCTCGCGAAGAGATCCAACTTTTCTTCAATACATTTCGCTGGCCAGAAAATATCAAAGGATTTCAAAGGAAAAGCATGGAGCTTC
AGACCAAACGACAACATGAACTGGAGCTAATCGTGGAAGGCCGTCAGGAACAGCTCACCACGCAGTTTTCGTCCTTGCAACGTCGTATCGAGAAGATGAG
AGATTACGCGAATCTTGCAGACTCGGAAAGCATTTTAAAGCGCATCGAAGCAGCCCGAAAGTCACTTGAGGACGCTGAAGCTGAAGCGGAATCCATTAAA
GAGCAGGAGACGATGCTGGGTATGAGTGTCACCAACAACCAGACTGCTCTGACAGATCTCTACGACATGCTAGGCCCCATTGAGAAGCTGTGGACTACGA
TATCGCAGACGATGGAGAAGGTGACGTTCAGTCGCGAGGCTCCGTTAGCAAGTGTGAACGCCGAAGAGATCGAACGCGACTGTGACCAGTTCCGTCGCAC
TATTGTGAAGATTATCAAGGAATGCGAGAAGAACACCGACGTATATGCTGTGCCCATCGCAATGGCGCAAGAAGTGAAGAAGACGCTGGATGATATGCTG
GATAACATCATCCCATTGATGGCTCTGCTGTGTACTCCTGGAATCCGCGAACGTCATTGGGAAGAGATCGAACGTATCACTGGAATCGAGGTGCAAGTCC
ACGAGGGATCGAACATCAACCAGATGATTGAGCTCGGTTTGCACCGACATACAAGTGCGATCGAGGAAACGTGTGTCAGTGCTTCGAAGGAATATTCACT
TGAAAAAGCTCTGGACAAGATGGAGACGGAGTGGGTGGGTATCAACTTCTCGACGAAGGAGTATCGGTCCACAGGTACGTCTATTCTGTGCTCGACCGAT
GAAATCCAGCAAATTATCGACGACCAGATCGTCAAGACCCAATCCATGCGTGGAAGTCGATACAATAAGCCGTACTTTGAACGGATCAGTAAATGGGAGA
AGATGCTCATCTGTATCCAAGACATCATGGATAACTGGATCAAGGTGCAGGCAACGTGGCTCTACTTGGAGCCAATCTTCAGCTCGGATGATATCATGCG
GCAGATGCCTACGGAAGGTGCGCTTTTCCGAAAAGTTGACTCGAATTGGCGTCGAAATATGCAGGAGACTGTGGCTTCTCCTGCTGTTTTGACGGTAGCA
GAGCGTAGCGACTTGCTACCAAGTCTGCAGCAGTCGAATGCAGACTTGGATACGATCCAGAAAGGTCTGAACGACTATCTGGAGACCAAGAGACTGTACT
TCCCGCGCTTCTTCTTTTTATCGAACGACGAACTACTTGAAATTCTCGCCGAAACCAAAGATCCGCTACGTGTACAACCACATTTAAAGAAGGCGTTCGA
TGGTATTTCTCAGCTTGAGTTCCAGGACAACTTGGATATCACTGCCATGCTCAGTCCCGAGATGGAAAAAGTACCTTTCCAATACGAGAAAATCTCGCAA
AATCTCATTAATCCTAACAATTCTGGAGGAAATGTCGAGGTGTGGCTAGAAGAAGTCGAGATGACGATGAAGAAGAGTGTGGCTCTCCATTTGGACGGAT
CGATTGTGGATTATCCGACCAAAGATCGCTTGGAGTGGGTGCAGCAGTGGCCTGGCCAAGTTGTACTGGCTGTTAACCAGACGATGTGGACACAGCAGAG
TGAAAAAGCACTAAACAGCTGCACGCAAGACCCGGATGCACTACGTGAACACTTGGAAGTACTGAGGACAGAACTGAAGCGAACGGTTGAGATGGTCCGT
GGTGAACTGCCCAAGCTTATTCGTATCACACTGGGAGCTCTTGTCGTCATGGACGTACACAACCGAGACACAATAGCCGAGCTAGTCGACCTTAAGATCA
CGGATAAAACAGACTTCGACTGGCTTGCGCAATTGCGATACTACTGGGTCCAAGGTGGGGTCTCGGCGACAACTGGCAAGCCCCATACTCTTGAGTGTCG
GATGATTAACACCCTCGCACTCTATGCGTTCGAGTATCTCGGCAACAGTATGCGTTTAGTGATCACTCCCCTAACCGACAGATGCTACCGAACTCTAACC
GGAGCGATTCACTTGAATCTCGGAGGTGCACCGGAGGGTCCTGCAGGCACGGGCAAGACAGAGACGACCAAGGATCTGGCCAAGGCAATTGCCATTCAGT
GTGTGGTCACGAATTGTTCCGATGGTCTCGATTATCTGGCAATGGGCAAGTTCTTTAAAGGTCTTGCGAGCTCGGGGGCATGGGCGTGCTTTGACGAGTT
CAACCGGATTCAACTGGAAGTTCTGTCGGTCATTGCTCAACAAATTCTGTGTATTCAGTTGGCGAAAGCTCAGCATCTTGCCCACTTCCTTTTTGAAGGC
ACCGAGCTGCGACTCAACCCGACGTGTTGCCCTTTCATTACTATGAACCCTGGATATGCAGGACGCGCAGAACTACCGGACAACTTGAAAGTACTGTTTC
GAACGGTGGCAATGATGGTCCCGGATTACGCGATGATTGCCGAAATTATGCTGTATTCGTACGGGTATATGGATGCCAGTGCGTTGTCCAAGAAGATCAC
GACGACGTACACGCTGTGCTCGGAGCAATTGTCGTCTCAGTCTCACTATGACTACGGAATGAGAGCTGTTATGGCTGTACTGCGAGCTGCTGGCAACTTG
AAGCGAGCAGAGGGACATCTGCGAGAAGATACTCTGGTACTCCGGTCGATTATTGACGTCAACTTGCCCAAGTTCCTGTCTCCGGATGTGCCTTTATTCA
ACGGTATCGTATCGGATCTCTTCCCTGGCGTGACTATTGATCCTCCGGATCGACGGGATATGCTGAATTCCATCAGCCACGTGTGTAAGCAGATGAATCT
GCAACCTGTACCTAATTTTGTGGAAAAGGTGATTCAGATCTACGAAATGATGATCGTACGTCACGGATTTATGGTCGTCGGTATGCCGTTTTCAGGCAAA
ACGTGTTCGTGGCGAGTGTTGTCCGAAGTATTAGCCCATTTGCATCAGCAATTTCCGACTGACACTCGCTATACCAACGTCATCGTGTCGGTGATTAACC
CCAAGTCGGTGACAATGGGACAGCTGTATGGCCAATTCGACGCCGTCTCGCACGAATGGAATGACGGCGTGCTTGCCATCAACTACCGAAATCTGGCGAA
TAACCCCTCTCCAGACCGCAAGTGGTTAATGTTCGACGGCCCCGTTGATGCGGTTTGGATTGAAAACATGAACACTGTACTTGACGACAACCGTAAATTG
TGTTTGATGAGTGGAGAAATCATCGCGATGAGTTCAGTCATGAGCATGATGTTCGAGCCCATGGATCTGCTTGTGGCTTCTCCTGCCACAGTCTCTCGTT
GTGGGATGATTTACATGGAACCCGAGCAATTAGGCTGGATCCCAGTGCTTAATTCTTGGCTCGACTCCGTCACAGTTGTGGAAGGCAGCATGGAGCCTCC
TGTTGGGCCGTTTGAAATCAATAGCGAGCAGCGAATTCTCATCTACTTCCTCTTCTCTTGGCTTGTTGAACCGTGCATTGCTTTCGTTCGGAAAGAGCTG
GTGGAGCTCTCACCGACTGTGGATACGAACCTGGTTCAGAGTCTTATACACATCTTGGAGGCGCAGCTGTGTAAGCTGCCGAAAGATGCAGCGTCCAAGA
AAAAAGCGACGATTGAAGCGCTCTTTATGTTCTCACTTACATGGTCGGTAGGTGAAAGTATCAGCGCAGAAGGTCGAATCAAGTTTTGCGACTTTGTTCG
CTCTATCATGGAGAATATTCAGTCGCTTGAGAGCAAATACATCGTCGTAAGTCGAGCACTTCAAGTACGCAAGTGGGAGAAACCGGTCTTTGAAGAAGGC
AAGAATACGTATTCGTTAGCCATCCCAGTGCCTGGCAAAGGGAACCTACACGACTACTACTTTAGTATCGAAGACAACAAGTGGTTCAAGTGGGAAGAGA
TGCTCAAACCGTACGTCATTCAGCCCAACACGCCGTTCAACCAGATCGTCGTGCCTACAATCTTCACTGCTCAATTGGAATATCTGGTCCAACTCCTTGT
GACGAACAAGAGGAAAGTATTGGTGTGCGGACCCACAGGAACTGGAAAATCTTGTTACATGACTTCGATTCTGAACGAAGTCCTGCCACAAGATCAGAAT
TCAGTCATTATGCTGTCATTCTCGGCGAAAACTTCGGCAAATATGACGCAGAATATCATCGACGGGAAGCTTGATAAGCGTCGTAAGGGAGTCTTCGGCC
CGCCACTAGGCAAGAACGCTATCGTTTTCGTCGACGATCTCAA