Description :
From Genome Similarity Track
Location :
Scaffold_415:1928- 6672
Transcript NameFunction/comments
Phyta_totarag8084hypothetical protein PHYSODRAFT_553035
Phyta_totarag8085hypothetical protein PHYSODRAFT_553039

Sequence
4744 bases(100 bases per row)
ATTATGTGGACCACCTGTGAGCGTCCATTGGCTACATGTTGCCGGCCAACCAATAGCGTCAATTAAAACTTGCACTGCATTGTTCGCAAAATGGCTCCGA
CGGCAGGTGCGTCGCGCTGCATCCCGCCTTGTCTGTCTATCTGCTTGGTCTACAGTAGGCTTCAACCTTCTTCTAATATCTCCGCGTCGCCTCTCTTCCA
GGAACTCGTCTCCGCTTCAAGAACACGCGGTCCAAGAAGCCGcagcaggccaagaaggtcCCGTCGCTCAAGAATCGCATCCGAGGCCTCGAGCGCTTCC
TCAGTCGCGGGGTAAGTGCGCTTGATGGCCACAAAATGTTGCTATTAAATAAAAAGAAATGCATCACAAGAGAGGAGTCTAACGGTGTTGCAATGTGCAG
GGACTGGCTGACGCCACACGGAGagccaagaaggcggagctccagcagctcaaggatgAGGTGCGTGTCGTGTGGGTGGTGCTTACACCATGCAATAGAT
ATCAAGAGATCCATAGGTTGTACTAAGTGTGTCTTATTGTTGTCTGCTATcagcacgagaagaaggaccAAGTTGCACTGGATAAGAAGAACGCTGAGAA
GTACAAGAGGGtgagtcgctggagctgctgctctccaaTACTTGCAGCTTTTTTAATAGTGTAATGTCAGTTGCTAACGGATTTGTGCTTCATTTACTAG
CCGCGCTTTTTCGAGCGAGTGAAGGTCATGCGGAAGCTGCGTCAGGCGAAGAACCGCACTGAGCAGGTGAGGGAGCTTCTCTCTAATGTTGCGGTAAGGC
AGCACAATGCTGAACATCAATGTTTACATTTGGTTATGACTGTTGCAGGCGAATGATGAAGCGGAACGCGCTGACCACGAAAAAAAGGTCAAGACGTATC
GTGAGGAGATGATGTACATCTACTACTACCCGAAAAGTGACCCATACATTTCTCTTTTCCCGTCTGCACCCCACACTGTGGAGAACCAAAATCGCCAGAA
ggagcttcgtgctgagGCGATTGCTCGCTTTGAGAAGGAGCAGCCCACGGAAGCGTTCCACCAGTTCTGCTTCAATGACGGCAAGTCCAAGGATTCTAAC
TCTGTAGGCGAGTCGAGATCAGCTGTTGAGCTTTTGCTTAAGAACCCCACGAAGGAAatggtgaagaagcaaaagaagGCTCGCAGCAAGCGGGACAAGT
CTGGAGAAAAGCCGAAGCACACTCCGGCCCTTGTCGACcaggaagacgatgacgacaacGAAATGCCGGATGCAGTCAAGGAAGTCAAGGAAaaggaaga
ggagcaagaggaggagcaggaagaggatgacTTCTTCCTGTAACTTTGGTATAGAACAGAGACGGTTGTGCGCAGGAAATTACAGCGGCAAGGTCTGCGA
TATAGGGTGCTTGTGCAAGCAGACTTTCGTACTTTCAAGGTCACGCGGTTGTTGAAATTTATTACTTTTAGTCTTTACGCTGACAAGCTCATGTGGGGCA
GGAGAGAAGTTGGTCACGAGGACAAGGCTGTAGAGGATGAGGAATCAGAACATCTCGAACTTCAGCTAGATCAGGATGGATGGGCCAGACGCAGTTCCTA
cggtttgctgctggatatcAGTGATCATTTCAGCTTCGGCTtgagatgcagcagcaagtgcgtTCATGTTTGTAAAACTGAAAGATCTGAAGGCATCAGA
GAGTTTGGAGTCATCGGGGTTACCGTACATTCCACTAGGGAACCGATAGTGATTGTTGTTGTCTTCCGCCTGCAAACCGTCGCCGATGTGCTCGTCCTGA
ACAGTGCCCTTTGCATCTAGCGCGCTTAGTGCCCCTGCGGTCCCCCATGACATGTCAACATCCGCTGTAGCAGCAGAAACATTGCCTGCATTGTTGTCAC
TATCCTCTTCTCCTTTCGGGTCGGGTAAACTTAGTGGCTGGTCGTCACTCTCAGGTCCGGAGTCGATATTGTTCTGACTGCTACATGCAGACTGAGAAGC
AACGTCAAattcatcgtcgtcgatgaatATGTCAGTGAGATTGCGGTTGTTGAAATAGCTGGTGTCGTTCGGTCCTTCCAGTGTCGGCACAAACGGAGGC
ACCGATTCCAAAATCGTATCCCAGTTGATGCCATCGAAAAACGGGTGTTGCTTGATCCCCTCCCAACCCATACGAGTTGCCGGGTTCGGGTCAAGCAACT
TATCTATCAAATCCACTGCCTCGAGTGACAAACACTTTTCGCCATCAGGCCACAGGATTTGCCGCTCCAGAATGTTCCCGAAGATCGCATCCACGGTGTC
ATCATTGAACGGAGGAAAACCAACCATCATTTCGTAGAGAATGATTCCTAGTGCCCAGTAATCCACAGGCGGCCCATGAGGGACGCCAAGAATGATCTCA
GGTGCCAGGTAGTCAGGAGTACCGCATCGTCCATACGTGTGATACGCGGACTTCTTTTTCGGGTTCCTCTTGGATGCTGAGGTTCGCCGCGGACGGCTGG
GTTCTGAAGCAGACGACGCATCTGCATCCACCAACGGAATGCCAGCCAATATATCTCTATCCTGGGCCATGGACTCATCGTCGGGTTCCGAGTCGGTGTC
ACTAAGAGCCACAGCTTCCTCGGACAAGCCGAAGTCGGTTAACTATAGGAGAAgtaaatttaaaaaaaaataaagaTAATGGGTGATTACGATCAGGGTC
GAAGGAACTGTAAAACAGCTAAACGCACCTTGATGTGGCCGGTTGATGAAAGCAAAATATTGTCGGGTTTCAGATCTCTGTACACAGACAAGTGGATAGA
CGCATTTACACAACGggtgaggacgaggacaaaACTTGCAATAAAATCAACCAAAGCGTCGTTCGAACCTATGAACACAGCCCTTGGTGTGCAAGTGATT
GAGCGCGATTGCAATCTCCGCAATATAAACGCATGCCACCTAAAATTGAAGACATCGACCAATCGTCAGTGAAAGCGTTTGGCATTTAGCCCACTGCATA
GCGCAAACTTacctgctcttccagctgcacaATGCACTCCAGTAACGACATGAAATCACCACCAGGAAGATACTCCATCACCAAAAAGAGATTGCGCCTA
ACAATAGCCAAAACAAGACCCTCGAATATAAGTTGCTGCCCGTATCGGTAAGTGAGCTTATTAGCATCGCAAACATGAACTGCTTACTTGGTTTGGAACG
TCCAGAACAACTTCACAACGAACGGACTCACAACACTGGCCAGAATATTCCTCTCTGTCTCAATCTGCTGGATCTGTAGTGGCACACAATGCGAGCAACG
GAACAAACGCTCAGTAGGCAGCACTGTGATTTGTGAACACGCTATGTAGCAGACATGGCGCTGTACCTGTTTTTTGCGCAGTAAGTGCTCTTTCGCGAGC
ACCTTAATCGCATACTGGTCTCCAGTCGTCTTCTTCCGGGCAAGATACACCTTACCGAATGCACCCTTCGAGATCGGCTTGACAATTTGAAAATCACGAA
TGGAGACACGGTAGGAAGCCGGCTTTAAGCTTGAACGTCGTGTAGATCGAAAGGTGTCACTAATTTCCATAtcctccagcgacttggtgCGCTTTAACGG
TGCTCCCACAACCTCCACAGGAGCCTGCTGGAACATTACCTTTTGAGACGCACGCATTTTGCTCATCTTTGCATGGATCAAGTTGCGCAGCTTTGTGCAG
TACTTGATTCCATCGACAGCAAGATTGGacgtctcctcctcctcctcctgttgtTGTCGTATCCTATCAATAATTTTCACTAGTCGGGCACACAACGCAA
ACGCATCTACACTGGTCACATCACAAGTAGAAGCCTGGATTGCCACCACACGCAGTGCATGATAAGTATGCATATCCTCCAGGTTAAACGTCGCCTCGGC
CTCAAGCGAAGCATTAATCGACGCCGTGAGCTTCACCAACGAGTCGTTAATGACATCcgcttccacctccaccCTCTTGGACAAGACGCAGTAGTTGATA
TGTTCATCCAAGCTATTCGCTTCCACTTTCGTCTCACACAATTTACACACCACACCTGACTTGTTCGCTCGTCGGAACGTCACCGTCATGGGTCGTTTCG
TGAACTGCAGGTTGTCCAGCACATCGTCAGGCGACATGGCGCTCGCATCTCGGCCATCCACAGCTTCCACCGACAACCCCCTCTTAACCGTCACTCCGGG
AGGGATGTGCGTGACCACCGTCGCCCACGTTTCCATCTGAACGCTCTTAATCACCACCTTGTTCTTCACCGCGTCAAACACGAACTCGAGACCGAGAAAC
CCGTCGCCAAAGGTCACGTCGAAGGTCTCGGTCTGCTGGACATTCTCGAACaggtcgtcgccgtcctccaGCAACGTAGCCGCGTCGTCAGCGGTGCAGT
CATCTTGGTTCtcgtcgttggcgtcgctggacgcGAAGCGGCGCCATTTGACCTGGTTCTTCTCCCAGCGGCTCAGCACGTCCTCTAGCACGTCCGGGGT
GGCGTCCAAGAGACCGCTACGGGACATGGAGGCCCCGCCGGCGCTGAAAGGCGGCACATTGAGCGTGtactggcgctgcagacgctgcggcTTGATCTCG
AGGCCCAACTCTTCGTGTAGCCGCTCCatctcgttgctgctggtgctgctggcgctaGTGCGTCGGCCGCTTCTGTCTGTGGggagctccagctccgcca
cgcGGGCCAgggcgagctgcagcggccgCTCGGCCATGAGGAAT