Description :
From Genome Similarity Track
Location :
Scaffold_509:1928- 4602
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_509-snap-gene-0.7Methionine aminopeptidase
Pytiw_DAOMBR242034maker-piw_contig_509-snap-gene-0.11Centrosome-associated protein

Sequence
2674 bases(100 bases per row)
CAAGCTCATCGACCTGTGCACGCAGCTCGAGAACAAGAACCGAGAGCTCGTGGAAGAGGCCGGCTTTGCGGTGCGTTAGACTGTGTATTGCATTGGCTAT
TATAGGTCTATATGTGTGGCTGACTTTACTCTGTGTGTGCTTGAGTAGAGAGGTATTGGCTTCCCGACGGGCTGCTCACTCAACCATGTGGCGGCGCACT
ACACGCCCAACATGGGCGACAACACGGTGCTCTCGTACGGCGACGTGATGAAGATCGACTTTGGCACGCAGGTGGACGGCCGCATCATCGATTCGGCCTT
CACGGTGGCCTTCGACCCGCAGTTCGACCCGCTGCTGGAGGCCGCCAAGATGGCCACCTACGAGGGCATTAAGCACGCTGGCATCGATGCGCGCCTGGGC
GAGATCGGCGCCGCGATCCAGGAGGTCATGGAGTCCTACGAGGTTACGATCGAGGGCAAGACGTACCCGGTCAAGTGCCTCCGCAACCTGTGTGGCCACT
CGATCGGCGCGTACCAGATCCACGGTGGCAAGAGCGTGCCAATCGTCGCTGGAGGTGACAACACCAAGATGGAGGAGGGCGAGATCTTCGCGATCGAGAC
GTTCGGATCCACGGGCCGCGGCCAGGCCGACGAGTATGGCGAGTGCTCGCACTACGCCAAGGCTTTTGACGCGCCCCACGTGCCACTGCGCCTGCCGCGC
GCCAAGAAGCTGCTCACGCACATCACGCGCACGTTCGGCACGCTGCCGTTTTGCCGCCGCTGGCTCGAGCGCGAGGACGGCGGCTCGACGTTCATCAACC
CCAAGGGCGCCAAGCAGGAGAAGTACCTCATGGCGCTCAAGAACCTCGTGGACTCGGGCATCGTGATGGCGCTGCCGCCGCTTGCGGACATCAAGGGCAG
TTACACGGCCCAGTACGAACACACATTCATTCTGCGACCGACGTGCAGAGAGGTGCTTTCCAAGGGCGACGATTACTANNNNNNNNNNACTCAAGAACCT
CGTGGACACGGGCATCGTGACCGAGTACCCACCGCTCGTGGACGTCAAGGGCAGTTACACGGCCCAGTACGAGCACACGATCATCCTGCGACCGACGTGC
AAAGAGGTGCTTTCCAAGGGCGACGATTACTAGGCCGGAGCTCAAATGCCTCAGCCTTAGGGTAAATCAGTCAGCTCGCTTGATTTGCATAGCCTTATTC
TTGATAACTTGAATGTCTTCATCTGGATCGTAATCGATTTTCCAATTGCTGTTTATCGCGCACCGCCTCCGCGTACTTGTACTTGAGGTCCTCGATCTCC
TCGAAAAAGTCTTCGTCGAAGGCCGCGAGCTCGCTCTGGAGCTTGTTGTTCTCGTCCTCGAGCTCCTGCACGTGCTCCTCCAGTTCTCTGATGAACTCGT
CATTCACAGCAGCGTCCGTGTCTGGCTCCTGGCTTGCATGCTCCAACTGGAACTGAAGCTCCTGGAGCTGCGTCTCCTTCCTCGCAATCGCTCGCTTAAG
CTCTGTGGCTTCACTCTCAGCGTGCGCCAATCGCTCTTCTTGGTCCTGAACTTGGGATTGTAGCTCTCGCAGCTCTTGTTCGTGTCGTGACGTTTCAGCT
GACGGTTTCTGAAACCCAGCAACACCTGAAGTCGCTCCAGTCGTCAGCGTAGAAGACGCGAGTCGAAGTTTCTGTTGCAGCCGTATCTTCTCCTTCTTGA
GCTCCGCGTTCTCACTTCGCAAGCTCTCCACTTCGTCCTCCAGCTGCTCTCTCGCGTCTCGGTACTCCTTCAGCTTCCTGCGAAGCACGTCCATCTTGCC
TGGAGAGACCGAGTGTTTCTTGAGCTTTTCATTCTCAGACCGCAGCTTCTCGATCACTTTCTTCATGTTCTCAATCACTTCTTCAAGTTCCAGCCTTTCC
TGTGCGGGCGAGCGGATGCTGCTGCTGATCGTCGCCCTGCCTTTCACTCCTAATAGACCAGTACGCCGTAAACTTTGTTGTTGGAACTGCGACTGCTGAC
TGCTTTCCAATATCGAAGTCCGCCGCTGCATTCGCTTGCACTCGACTCGGATCGTCTCGAGCTCGAGCTCCATCTCCATCATCTTGGTGTCCTTGACGAT
GATCTCTTGCTCCTTAGCCCGCAGCTCGTCGCCCAGCACCACCAACTCGTCCTCAGCCTCCTGGGAAATCAAGAATTGCTGCTCTTCCAGGCGAAGTCTC
TCATCAGATCCTGATGGCACTCCGTGCTGCGATAGTCGACGCCTTAGCCGCTTGAGATCCGCCTCATACTTGGTCATCTGCTCCGTGAACGCGTCTTCCC
ACTCGCGCCGCTTGAGCACCAAAGTCTCCTGAAGGTAATTGTTCTGGCGCTCGAGCTCATCGATCTGCTCCTTCGCGCTCGCTGGAATTGATGACAACCC
ATCCATGACTCCAGCGTTCGCTACAGCAGCTCGCTTCTGCTCGGCTTTCTTCAGCTGCGTCAGTTCCTGTTGCGCGATCGCAAGCCGCTCCTTGATTTGC
TTCAACTCCTTCTCCTTCTCGTCAAGCTCGGCGTGTTTTTCTTTCAAACGCAGATTCAACATCTCGTTGCGGCGCTGGAGCTTCTTCTCTACTTCCCACT
GCTCACGGCTCTTGCTTGAAATGTCCGCGGGCGCTCTTTTCTCTGCCTCGAGTCTCTCATTTGTTGATGGCATA