Description :
From Genome Similarity Track
Location :
Scaffold_36:192726- 194149
Transcript NameFunction/comments
Phyca_LT1534118349haustorium-specific membrane protein, putative

Sequence
1423 bases(100 bases per row)
atgccccccttctgaagatcgagggatccacatcagcagtgaacccccacctttacctggcaatcccagaaaccctgaacgccagcgatccaagtacaag
gtcttgtcctccagttctgggaatgtcgcggtccaagtggtcacatcgccagcaccaatgtcgatcttggcgtattcatcacctccagaatagaccacaa
ccgtcacgtccttgttgtcaatactctcgaaaatgaggcggacaacgccatcacctgcgtggctgtaagtcccatagcttccttcaaacgcttcatccat
tgtagtcagtccaagtgcgtcgttcagcgttccatcatcgatttcccctacataagccgtaggtccacagataggctgcacgaactgtgaagccatgtat
gcgataccggtcgggtcaaccgcggataacgctataaggcccatattggacactttgagcatatagtctttgtcagccacctccgtgccgttatccgact
tgcctgtttcgatgagttcgtctacgatcactccgaacgttttccggataaggtcacgggtctcataggctgccgtcaccgttttgctcgccaagagttc
gcccatgcagttgttagtgacgatggggatgtcgttcagtacaatcgaagacttgtacactttgactcgtatgtcgttgacctccgagctcacagtgcga
tacttgagaacagctctagtgactcgatccgtgagtcgtttgagctgccacccacaactcgagttctgcgccacaagatcgtcgagttccgccactgtcg
tagcggacttgttagcgattccattaccagtcagtaagttcatgacattcgccccagtggaaataatgtcgtctccgttggtaattgtttgtttcacgat
aaactccacagcggagagcactttatccgcccagtgtgcgttcttgggaattgggatgttgagacaagagcaaatggcaatagggaggtcgaacagaacg
acatctgcctgatacgcagcggttagcaattcctcggacgtccctgtcggcgtggttctttgccgatatcggatatagtaaatgagacttcggatcactt
caacaagattccgaacgcacaaaacagcccactttgcgatcttgtacgttgccagaattgacccaaacacgtttaaagtcgcagcgttaagagccacaac
gacaacggacacgatcttgttgagaactgccatgacgcagttgtcgttttgggggatacactccagaccacacgaaatcggatacgacaagggacaccgc
gcttcacagtcgtcaccgtctctactgtaccccaagggacagatgttgttgctgtcaaagtccatcgacttccgataacacgcggtgtcggtggacttgg
aaatggtggggcccacccagttg