Description :
From Genome Similarity Track
Location :
Scaffold_1:192711- 194195
Transcript NameFunction/comments
Physo_478727multicopper oxidase, putative

Sequence
1484 bases(100 bases per row)
TGCTATCTCGTAAAACTTAAAACGCTACGTCGCTTTAATTCCTACGACTCTTAAATTGTACGACTCGTTAACTCTACAACTTGCTCCAAGCATGAGTCTT
TCAACACTAGTCGTAAAACAAAACTAGTCGTAGAAAACTGCAAATCGCAAAAAAAGGCGTAAAAAATAACTGCAAAAATAGAACTGGTGGGATTCTAAAT
CTGTAGTGCTATTTTTTCTTTATTTCATACCTACGGAGTGGCACATACCTACTTACGTTTTGACAAATCGGGCCAATCTACTTAGCCAGTTTAATTCCTC
AATACATGTATTGTGCTTTGCAACCAGTTTGCCCTCCTAATTAGTGCACTAGTTAGTGTTCGTACTTAGTGGTAAATCATAGTGGCTTTGAATGCGACTT
GCTCAAGTCGTGTTTCGAAACCAGTTTGGCTCGGAAATGGCACTTTCGGAAAGTGCCAAAAGGATGCTAATCCATGTTGGATGTGCTAAATCATGCAGGA
GATGACATATGCGCACTTGATTGACCATTCACGACATACAGCAATTCGTACTCGAGTACGATTTATAGATAAGTCGTCGTTACAGTCCGAAGTGCCAAAA
AGTATGCAAAGCACAATACTGTACTTAGTACATACTATTTAGGGTTTTCCGTTGGCACATCACGAAAATCGACCCAGTTGTTTACGCAGTCCGATCCTGG
TTGGTGCATACATGTACAGTACAATGCAATGCAATGTCTTTGTTGATAGTGATTCACTTACATGTAGTTGCCCAATTTAGAAGATGACAGGACCAACACT
AAGAAGTCATGTACCAACTTCAACTCTATCCACGGTATAGTACATGCAGATATATCTCGACGTTTTGTAGGCTCCTGCTCCATGTCTGCTCTAATTGTTG
AACAAGACACGATATTATAATCCCCAACGGTCGATCAACTAAGCGTTTGCAATGTGTCGATTAAACTGCGACGAGCGACTCGCACATGTTGGGAAGTTTG
TGTTTTTATGCGGCAGTGCCGATTGTTATGAAAGTTCTTTGGAGAGAGGATTGTATTTCTATAGATTAATTAAGGGGCTTCTTGCTGGCCAGATGCTCAG
CTTTGGTATCGTGAGGTTGCTCCGCTCCACTCTAGGCTGACCGAATACTTGGAGGCGCAACAGACACGCGCCTATTCAAGGCGTTTAAGCACATTTATCA
GTTAGATGCAATGGTGCAAGTGTTGGAAGCAGGCCATTTCCATCATTCGGCAATTTACTCTGTTCCCAGCAAACTCAGCTACGTTGTGCCATGGGCTTCC
GTCGACTCTCGGCATACATAGCAGCCTTGCTGGCGCTTCATATCGGGCCCAGCACGGCTGACCTCGTCACGTACAACTGGCGCGTCACCGAAATCACTGC
GGTGTTTGACGGTATTCCTCGACCCATGCTCGGCATCAACGACAAGCCGTCAGACCAAGCAGTAATCGACGTGAAGCTGGGCCA