Description :
From Genome Similarity Track
Location :
Scaffold_329:19270- 20858
Transcript NameFunction/comments
Phyke_g8448hypothetical protein PHYSODRAFT_345031

Sequence
1588 bases(100 bases per row)
GAAAGCGGTCGCCGATTCGCGTGGAAACGACTTCGTGCATTTGCACGGAAATCCCGAATTCCGGAAGCTCAAAAGGCCGAAACGGCTGCACTTTGAACTT
TGCAAGTCCAGCTCTGGGGGGAATATGTAGCATTTCGTCCTTGTAAGCAGATAAAGCCGATTCACTGATGATGACTTGGCCACCTTGCCCCATTTCGCTC
ATTTCACGTGCCAGCATCTCGCTGAGTCCTAAGTATGTCATTTTGCCTGTGGTGGGATGTCTTGCGAACACCAAGCGctcatcgccatcgtggaTCGCCA
TGCGAACTCGAAGTCCGTTGAACAAAAGTCGCGTCCAAATGTCGTATACTCGTGCCGAGTTGTCGTGCTTCAGCAGTGACGTAGGCCACGGGGCCTTCAA
TagcttctcctgcacacTCACGCACCAATCGATAGCGTCACAGACACAATGGAATGCCAGCTGGAACGAGTCGCCACAAGTCGTGATTTCGTAACCACGG
AAACGTGGCAGCTGTTGACGTAGTAAATCGTCGTGAATCGATTGAGCCTCCGCCATGGCTGGCGAATTGGCGGACCAAAGCCGACTGGAGCCTTCAATAT
CTGTAACTACGAAAACTGGTCGCCGGGTTGGCGGTTCCACAATCACATCCATCCCGTTCAACCTTTGATCCTCTGGAAAGAAGCCGCCCTCCAGAAGTTG
TTCATACACGGACGGTGGCATGATAGGCCGCAAGGTGcggaagcagcacgaggcGCTAATACCGATCGCGAATACTGTCCCTCCACCAGACAGATAGTAC
AGAATTTGAGTGAAGCCCACCCACTCCATCTTGATGTCATCCACGAGGCGGATCAACACCTCCACAACACAGGACGGGAATACCAGCACGCAGTACACGA
TGACGAAAGTCTTGATACGCTGGTGTAGCAACAACGACGCTGGGTCCACTGCGCTTCGAGCGCGCTTCTGACATGAAATACGAAACGTGGCGTACACTGG
GTACAGCACAGAGACCCAAATGCAGGCCAGTTCGACCCAAAAGGCGacagtctgcagcgtccCTGCTGGTGAGGGTGGCAGAAATGCAGACACGACCATC
AGGATGGCAAATACTACGGATGTACCGTACGCGCGAATGCAATATTGGCGCGTGATGGCACGTTCGCGGCTGGGTCCGCGATCCATCGACTTAATAATGA
GACGCTTCATCTCGTAGGCCAGGGTGACGATGAAAAACGTTGTGCTAAGCAAAGCACAGTCTCCAATAAGTGTGACGATCACTGGGAAGGGCTTGCGCTT
CCCCTCTGAATAGATAGTTCTTGCGCCCATGAGTTCACCGTTGTCCAATGAGTCTAAAGTGTCCCGTAGCCCGTCGAAGTTGGCCAACACACCCACATAG
AGCACTAACCGCGCTAGCGTGTAGATGAAGTACATGCGGCATACCGAATACGTGAGGTACTGCACGGCCGAGTCGCTCAccttgatctgcttgaaCGAAA
GCAGCAACGTCGCGCAGGATGTGACCGtggccaccgccagcacgaTCACATACGTCACCGTCCAGTCGTAGTGTGTCGAGTCATCCAT