Description :
From Genome Similarity Track
Location :
Scaffold_53:1927- 6234
Sequence
4307 bases(100 bases per row)
TGGAGATGGTGGATCTCGGATCCGGCGGTGGTGGATGGGGCCTTGCCCGGCGATTTGCTAGTACGCTTGGTGGGGGACATGTGTCACGTAGAGGAGGAAG
CGGTTGTGGATGCTGGTAGTGCACGTCGTGAACGCTGTTGTGCACCGCCAACCACGCACAGGAGGCGATGGTGGTGAAGTGCTTTCTCGTCAATAAGAGA
ATGAACCTAACGCGGGGCCACTGCCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGAATTGTCCGGCGCGGAGGCAAGTTGCCTGTGGTGG
ATTAGCCATGGCGAGCAGCACCCCGTATGAAACGACGATGGATCTGGTATGAGTGATGTACGGGAAGGCAAGATCCACCAAGACTTATCTCGGATCCACC
CTTACCTGGATCCACTTAGGTGGATATGGGATACGCTATGTACGGGTGGATAGAGGGTGGATCCAATGAAGGAATGGTGGTAGGTGTCATCTGAAGGTGG
ATCTAGCAACCACGGCTAATGAGAAGTCAAGATCCACCGCGAGGTGTCCCGGATCCCATACTTCCGAGTTCGGATCCAAGGAAGGAGGATCCCGCATAGA
GTGACCTGGATCCAGGATCCAGGGATGGTGGATACAGTGGATCTCGAGCTTTCGTGGAGTGATGAAGACCACAACCTGTCGTAAGACAATGTTGGGAGAT
TGAAGGGCCCAGATCCATGACGAGTGTACACTTGTAGTGAGGTGGATCAAGGTGGCCTGGATCCGGACAAGTGTACCCATAATGTGACGACCATAATGAT
TACGCCATGGATCCGGTGGATCTGATGATAATACAGCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTCTCGGGATCCAGGGGGTTCAAATTCTCCGCTCCTAATTTCGTCAAAGACAGATAT
TTCGGCACTGCCCGCATCGGTGCTTCCAATTCTTTTAAGGCGCCTGGTTGTCCCTGCTACCAGTAATTTACCTTCTCCCACAAACCTCGGCATATAGGAC
GATACCGGCCGGTGTAAACCGGATTCCGCAAAGCTCCATGAAGTATGTAGGACATGCAGGAATGTTTTCCCCCGTACCAAAAATGGCCTTTCAAATAAAG
CCCCTCTGTTTGGCAGGCCCGTTTTTCCTTGGCTTCGTTTATGTACTGCATCAACTTGGCCCCACAGCAGGTGCTCTATTCATATCCTTGGACAGCATTT
CAACAGCGTTATAGCCTTCATTTAAAAGCCCGTTCGTCAAATATAAAAACTTCTGATCCGCTTCCGCACTTCCGTCTCATGCTGAAAGGCCAGCTGCTTG
GAGCAGGGAACCTTTCGCTCGTACAGCCTCGGCGCCGCCGTGACCGTCTCGACGGTCAGTTTGGTGTAGTGCCCCTGGAAGTCATTCGGGCAGCGCTCCA
GCCCCGGGCAGGCTGCACAGCTGCGGCTGTCTTTGACATACTGGTACAGCTTCCCGAGATGAAGCGTCAGCTGGCTGCGGTCCAGCTCGGGATGAAGCTC
CAGCAGCTCGATAATCAGCGGATCTTCAAAGAGCTCCTTCATGACTCGCTCGGAACGGGCCTTCAGCTGCGGACTTTTCATTTGGGACAGCAGTTCGCCC
AACGATTCCATGTTCCGCCCCTCCGTTTCCTATTTTAAATCGGTTGATCTTTATTTCTTCTGACCGTTTTGCATCCGTTCCGCCATTTTAAGCAGCTCGG
CAAATTCCTCTTCTGACAATGTTTTATCGTTATTTACTGCGCTTGGCACAATCGGGATTTCAGGTTTCGCTTTATTCCCCCGGGAATAATTCCGGCTCCG
GCCCCCGGGCGTAACGGGAGCGGTATTATCCTTCACTATCTTGTTTAGCTTCTCCTGGTCACGGATATAGCTGACCGCCTTCTCATCGTTTGTTCAACGA
ATTAATGCGTGTGCGTTTATTGCGCTTTGGCGTGTTGATGTGTTTTTGTGTGTAGCTTGTGTTTGGTGTGGTGCTGAGTACAAGGATTGTATTTAAGTAG
AGCGCTTGTGGTGCTGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGATACCCTGCTTCTCCACTGATCA
TGTTACTGTGATAAAATCAGTTGGCATCAGCACTTTCCCAAATGTGCACTTCGTAGTTTGTCTGCGACATCGGCTGACCTTGAGGAACATTTTCTTTTGA
TTGCTTTTTTGCTTCTTGCCTGCCGTCCTGTCTTTCGTCCATCTGATTGTCTCCCGTTGATATCACTGACGGTTCCACGACACGCTTGTATTGGCGTTCC
GTTGTTTGTCTATCGATTAATCCTTTGACACGCTCCTTGATTCTGCCATAACAACGTGGAAAATTTCCTCCCCCCCCCTTAAAAAACTGGCTGAAAAAAC
ACCACAAAAATTTTGTCTTGGGCTCCTAAAAGTTTTATGGTCCTCTGGGGGGCTAGTGCTGGAATGGTATTCAAAGCGACTCTCTGTTAGGCCGCAAATA
TCAGCCAAAACCACGCCAAGCGTTTCTGCCAAAACAAGGGTCCAAGATATAAGGAAACTATCTTTCAGAAAGTAAATGGCAAGACTGTGAGTATTCAAGC
AAACCAGGGGCACCCCTGGCGCCCCACACAGATGTCTGGATACAGTGAGCGACAACCGCGAGGAGTCGGAGAAGATGCTGAAGATGCGTGGTGACTGGTG
TTTGATATCGCTTCGTTTGGTCAATGAATCAATGCGTGTGCGTTTATTGCGCTTTGGCGTGTTGATGTGTGTTTGTGTGTAGCTTGTGTTTGGTGTGGTG
TTGAGTACAAGGATTGTATTTAGGTAGAGCGCTTGTGGTGCTGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAAGG
ATCGATACCCTGCTTCTTCTTTGATCATGTTACTGTGATAAATCAGTTGGCATCAGCACTTTCCCAAATGTGCACTTCGTAGTTTGTGTGCGACATCGGC
TGACCTTGAGTAACATTTTCTTTTGATTGTTTTTTTGCATCTTGCCTGCCGTCCTGTCTATCGTCCATCTGACTGTCTCCCGTTGATATCACTGACGGTT
CCACGACACGCTTATATTGGCGTTCCGTTGTTTGTCTATCGATTCATCCTTTGACACGCTCCTTGATTCTGCCATAACATCGTGACACTTCCGTCCAGCT
ACTAGCTGCCTGAATACCACCAATAAGTTTTGCTTGCCGCTGACAGTTTATTGCTTCTGAGGTTAGTGCTGAGCTGTATCAGACTGACATCATTGATAGC
AGCGAATACCAGCACACACCAGCGCAAGCGTTGTGCCGAACCAGGCGTCGACGATCAACGACACTATCTTTCAGAAAGTAAATGGCAAGACTGTTGAGTA
TTCAAGCAAACCAGGGGCACCACTGGCGCCCCACACAGATGTCTGGATACAGTGAGCGACAACCGCGAGGAGTCGGAGAAGATGCTGAAGATGCGTGGTG
ACTGGTGTTTGATATCGCTTCGTTTGGTCAATGAATCAATGCGTGTGCGTTTATTGCGCTTTGGCGTGTTGATGTGTTTTTGTGTGTAGCTTGTGTTTGG
TGTGGTGTTGAGTACAAGGATTGTATTTAGGTAGAGCGCTTGTGGTGCTGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGG
TACAGGGATCGATACCCTGCTTCTCCATTGATCATGTTACTGTGATAAAATCAGTTGTGGACGCTGCTATTGTAGCGAGTTGGCGACCGGTTTGTCTGCT
GCGGCGTTAATGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAATGCGCTTATTGGGTGATTTTCCTGCTGTGGCGTGANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTAAACT
GTCGACCTGAACGCCTAGATTTCCACGACTAGTGAGAGAGACACGATACTTTCGTGGGGCGAAATTTGGCAGCTGGGCATTGCATCCTTTCATCCTAGAC
TCCTGCCGGGGTCTCTTGCTCGTGGCCTGGGACTTAAATTTCCCGGAATAGGTGCAAACAAAGGTCTTTGCGTATTGCACCCACTCGTCAGGAAGTTTTT
CCGCCTT