Description :
From Genome Similarity Track
Location :
Scaffold_241:19268- 20610
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_241-snap-gene-0.17DNA ligase

Sequence
1342 bases(100 bases per row)
CATTCGCTCGTGCTCGCTCTTCTCCGCCATTATCTCATTCTGAACTCGCAGTTGCTTCAGCCTCTCCTTCCTTGCCTTCGCGTGGAGCAATCGCGCATCA
ATGAAAGCCTTGATCGTCGTTCGAGCCACGTGTTCGTGCAATTGCTGCGAGCGCTGCTTGTGCGTCGCAAGCAACTTGTGCTGGGTTTCAGTCAGACTCG
CTTTCTCTTGCTCGAGCTTCGCCATTTTTTTATGCAGCACACGAAGCTGAACCTTGTCTTTCGCTCGCCACTGAGCAGTCTCAAGCTCCAATATCGCCTT
CTCCTTGGAAAGAATGCGCCACTGGTCGTAATTGTGCGCCTTCTCTTTCACTATACGCTTGATCTTGCGACGCAGCAGACAACTGCCGAGAAAAGTATAT
ATCTTGAGCTGCGCGAGCTGCCGCCTTTGCTTCTCTTCCAGATGCTGATGCCGTCCAAGAACACGCTCGTGATGGCTCAGCAACTTGGTTCGCTCAGTCT
CAGCTTGTTTCCATTTCGATTCCAGGTCGTGGATGGCACTTTTCATTGCGCTTTCGACTCCTCGACGTTGTCGTGACTCTTTCTTCCGACGCTTCTCGTC
CTCTTGACGAGCCTTGAGCGAGAAGAGCTGGCTTTTGAACAGGATTTGCTGCTTCTGAGCAGTAACTCGGTTGAGTCGCTGGCGAAGAACGGTCTCTCGA
AAGAAACCCTGGACTTCTTTTGCTGCTTGATGACGACGCTTCTCAAGATTCAGACAATCCACTCGTTCCGCTTCTTGTTTCCTCCAGACATCCCGACGGC
TTCGCCACCAGCGATAAATCTTCTCCTTGGCTGCTTCACGCCGCCATCGGCACTTGTTTGTTCGGACGAAGAACGTGAAGCGCCTGAAAGCCATGTGCGC
CGATCTGAAAGCTGCTTTCTGCCGCACCAGATGCGCGTACAGAAGATGGCCCACCCAGACTTTCTGTATCCGTCCTGCAGCCGCGTGTTTCTTGGATGAC
TCCAACTGCAGTTGAGCAAACTGTCGAGCACGATGCGAGTCGTATACAAAGTGACAAAGTTGGCGTAACGCTGTCCGTCGTCTCAGTGCTCGCTTCGCTT
CTTTCTGTTCCAAAGCAAAGTCCCTCCATGGCCTGAAGTACCGACGCAGCATCTTCAACTCGCGCTCCAGGTATAGCGGAGGCTCGTAGACGCTGGGGAC
GAATCTCACGATCGATGGCTGCACTGGGCTGTGACGCTTGAACTCGTTTACGACGAGATTGTCCAGGTGGTAGCCCATATCAAGTGCGGTGACCTGGACA
TCTCGACAGAGCGCGTATATCTTCTCCAACACTGGCTCATCA