Description :
From Genome Similarity Track
Location :
Scaffold_36:192662- 194148
Transcript NameFunction/comments
Phyca_LT1534118349haustorium-specific membrane protein, putative

Sequence
1486 bases(100 bases per row)
acgaaactcgtactattcaactcaaatacatctaggacgcgttgatcctcacatgcatggtgatatgccccccttctgaagatcgagggatccacatcag
cagtgaacccccacctttacctggcaatcccagaaaccctgaacgccagcgatccaagtacaaggtcttgtcctccagttctgggaatgtcgcggtccaa
gtggtcacatcgccagcaccaatgtcgatcttggcgtattcatcacctccagaatagaccacaaccgtcacgtccttgttgtcaatactctcgaaaatga
ggcggacaacgccatcacctgcgtggctgtaagtcccatagcttccttcaaacgcttcatccattgtagtcagtccaagtgcgtcgttcagcgttccatc
atcgatttcccctacataagccgtaggtccacagataggctgcacgaactgtgaagccatgtatgcgataccggtcgggtcaaccgcggataacgctata
aggcccatattggacactttgagcatatagtctttgtcagccacctccgtgccgttatccgacttgcctgtttcgatgagttcgtctacgatcactccga
acgttttccggataaggtcacgggtctcataggctgccgtcaccgttttgctcgccaagagttcgcccatgcagttgttagtgacgatggggatgtcgtt
cagtacaatcgaagacttgtacactttgactcgtatgtcgttgacctccgagctcacagtgcgatacttgagaacagctctagtgactcgatccgtgagt
cgtttgagctgccacccacaactcgagttctgcgccacaagatcgtcgagttccgccactgtcgtagcggacttgttagcgattccattaccagtcagta
agttcatgacattcgccccagtggaaataatgtcgtctccgttggtaattgtttgtttcacgataaactccacagcggagagcactttatccgcccagtg
tgcgttcttgggaattgggatgttgagacaagagcaaatggcaatagggaggtcgaacagaacgacatctgcctgatacgcagcggttagcaattcctcg
gacgtccctgtcggcgtggttctttgccgatatcggatatagtaaatgagacttcggatcacttcaacaagattccgaacgcacaaaacagcccactttg
cgatcttgtacgttgccagaattgacccaaacacgtttaaagtcgcagcgttaagagccacaacgacaacggacacgatcttgttgagaactgccatgac
gcagttgtcgttttgggggatacactccagaccacacgaaatcggatacgacaagggacaccgcgcttcacagtcgtcaccgtctctactgtaccccaag
ggacagatgttgttgctgtcaaagtccatcgacttccgataacacgcggtgtcggtggacttggaaatggtggggcccacccagtt