Description :
From Genome Similarity Track
Location :
Scaffold_160:19265- 22754
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_160-snap-gene-0.17Conserved oligomeric Golgi complex subunit 8
Pytve_DAOMBR484maker-pve_contig_160-snap-gene-0.24Hydrolase

Sequence
3489 bases(100 bases per row)
AGTGACTGTTTCTGAAGCGACCGCAATCTTCGTTCCTCTCCACCGTGATTTGTAACTTATCCCAGAGTCGATGCTCTGCCGATCCAAAGCGAATTGTCGA
TTCTTCTCGTGGACGCACGCACCACAAGACAGCCACCGCGCGAATTCTGGTGGATTTGTGCCCGATCTTTCAGTCCCTGCTGCGCTGTGGCTCCATTTTT
CTTGTCTATGTTTCCGTGACGAGCCCGATTCACCGTTTAGTTCCGTCAAAGTTGCCGCTCGAGCAACCTCGACCGACAAGCGACCAGATCCAGTTGAAGA
GCGTTGCGTCAAACTGATTGCGGCATGAGGCGAGCTCCTCATGGCATCCCGTTGGTCGCCCTCCATCTCTCCCAGGGTGTCTGAGCCGCCAGGTGCTGGC
ATGAGCAAGTGGCGTCACGCTGAGCTCTCGCATTTGACGAAACCAGTTGACGTGCATCAAATTAGCGAGTGCATACTGTACCGTTGCAATTGGATCAATT
ATAACATCCACTAATTGGTTGTAAAATGATTCCTCACTTTTCGATAACGAATTATGTGAATAAACGGTGCCGAATAATTGCGAGTCTCAAGAAGAGTGGG
GCGAAAATGGAGGCGGTCCTCAGGTCGTGCTCGCTCGAGGAGCTCAAGAAGGAGCCGTGGCGGCTGCAGATTCAGGCGGAGAACACAGCCGAGCAGCTGC
GCAACCTCGTGCTCAAGAACTACCACGTGTTCATCCAGAGCAACCAGAGCGCCAACATCGTCAAGGACGACGTACGTCAGTTGGATCCGCAAAGGATCGC
TTTTCGTGTCTGACGCTCGTTTGTTTTTTATCTTGCCTATCCTTCCTCTCGGTCGGGTGGTATATGCAGTTGGTGGAGCTCAAGCACGAGACGAACCGCA
TCGCCGAGTCGATTCCGGAGCTGCAAGCGTTCTGCGCTGAGTTCCAGAAGGAGGTGGCGGACGTCGTCGCCAAGCACGGCGACATTCAATTCGTGTTCGA
CCACTACATCCAGGTCGGGACTCGCCGATCAAGCCGTGGAATTACAAGTCAGAGCACTGACTTGATGTTGCTATTGTTGCTGTTGTTGCTGCATAGCTGA
CGGAGCTGTTGGAGATCCCGCAACTGCTCGAGGCGTGCATCCACAATGAGCTGTTCGACTCGGCGCTCGACGTGATCCAGTTCGCCAACGACACGTTTCA
GACAGATCCATCGACGACTTCTTCCGCGCCGAACGTCGTGATTGAGTGTTTGGTGCGTTACCTTCTCTTTTATTGACAAGACGAAAAGCATGAACTGATG
TGGCCATGCAGGTTCGCGAGGTGGCGGAGATGACGGCAGTCATGCGCGAGAAACTGCTGCAGAAACTCCGAGAAGATCTGCAGCTCGCGCTTTGTGTTCG
TATCGTGAGTTACCTTCGGCGCTTGGATGCAATGTCAGGTGCGAGCGCGGCGATCAAACCGGCTGACTACGAGAAGCAGCTCAAGGAAGAGTTTCTGAGC
TGCCGGAACGTCTGGCTTTCGTCACTGACGCGCGGGATCTCGACGTCAGATCCGTACCAATACGTGAGTTCTCGCTCTCACCAGGTGGATGTTCCTGAAG
ACAATCCTCTAACGGAGTTGCCATTGATCGGTGACAGGTGGTGCAAGTCATCGATGTCAAGCGGACGAGCTGGTTCGACATGATCACGCAGTACTCGGCG
ATATTCGGCAGCGAGAACGTCCACGGGAAGGTCGACCCGCCGCTATGTCGATGGGCGACCACGACGGTCGCCACGTTTATCCAGATTTTGATGAAGTAAG
TTATGCTGGACGGTGTGAACGTGTTAGAACGAAGGAGCTCATGAACACCGCTGTCATTGTGACGAACTGTAGACAGCTCCCCAAGATCGAAGATTTCAGC
TCGATCGCCACAATCCTCGAGCAAAGTCTCTTCTTTGGAGGATCGCTGGGCCGTGTCGGTGTCGATTTTCGGGCAGTGTTGGTGGTGTACTTTGAGAACC
ACGTCCTCGATTTGATGACGGAGCAGTGGCGCGCGGCGTGTCGCGACTTTCAGGAGAATCTGAATGCTCATTCCCTCAAAACTGGCGCTGGAGGAGGAGG
CAGCACCTTCATTCCGGCGTCCAGCAGGACACCGATCGTGATTGCTTCGTACCGGTCGGCTAGCTCCAGTAGCGCACTGCCGTTTGCAATCGGAGCGACA
TCATCAGCGCAAAGCACCAACGACATCGACTACGCGCCTCCGCGATGTCTGATGTCATTCCCGCTACTTGCCGAGTTCACGAACGCCTTGCTGACATCGC
TGAACGAGCTCCGCCTTTGCACAATATCGTCTCTGCGGAACCGACTGAGCAAGAAGTTCCAGAGCGCGATTTGCACCATGCTGCTCGCCATCGCTGACTT
TGTCGACGAAAACGATCTCGATCTGTCATCAAGCTCAACCGCTGTGGACTCGTCGGGCGACGATGATGTCTCTACGGCGGCCAGCACTTCGGGCAAGCAG
GCGAAGGTCGCAGCATTGACCAGCGCGATTCGAGACATGAATGAGGTACTCTCGAATGTGCTCGGATCCCTTCGAACGAGATGCTGACTTTGTGTGATTG
TGTTGATGCCAGGCCATTCAAACTGAACTCATCCCGTACCTCGTCAAGTGCTTTCATCGCCTGTTCCCATTGCCACCAGCGGCCAAGAGCACGTCTGCGC
TCCAAGTGGCGTATTTCGAAGAGATCATGCGCGAAGGCGGTCTACTGTCTGTGACCCAAGCCACCGAGGACTCAAACAACCAAACGGCGCTCAACTCTGC
GTCGTCATGAACAGAATGATGAGTTTTGCAGCAGCAAGCACTCTGCAGTGATGAGCGTGGTCATGTTGAGTCTATCCGTACAACATGCAGGCAAAACGAC
AAGGGTGGGGAGGACGAAAGTAATGGGAGCACTCCATTTGACCGCACGTCCTGCCGCTCACTTGGGTGGGAAGGAGAGCACGAGTCCGTCGTACGGCATC
TGGATGTTGAGTCCCTTCTCGCGACCCATCTTCTCGACGATGACGCTGTGCGTCGGGTAGTCGTAGTCGTGGCTCATACCCGTGAGCAGCGTCAGCTTGG
GGCGGATCGTCTCGAGCTCGGTGATGGCGTCCACGAGGTTCATGTGTGTGCTGTGGAACTTGTCGATGTACAGCGCGTCGATGATGAGCACGTCGATCTC
GCCCTTGGACTTGTCGTTTAGGTACGCGCGCGTCTCGTCCGAGAAGTCGCTCACGTCCGAGATGTACACGAACCGCGTGCCGAACTCGTGACCGAACTCG
AAGGCGAACGACGTGTACCCGGCGCCGTGGATGACGGGGATCGGGAGTAGCTCGAGACCCGAGACAGTGAAGGGCTTCCACGGATGGAACTCCTCGAGGC
GCACCTGCGCGATCCACCGGAACGGCTGGACAGGTGCTGGCGCCGTCTCCAACGCCTCATCGAGCAGTGGGAGCGACGGGATGTTCAGG