Description :
From Genome Similarity Track
Location :
Scaffold_65:192637- 200081
Transcript NameFunction/comments
Phyca_LT1534530472protein phosphatase 2C putative
Phyca_LT1534510717diguanylate cyclase
Phyca_LT1534530474PREDICTED: acyl-CoA-binding protein isoform 1
Phyca_LT1534536873unnamed protein product
Phyca_LT1534126772pumilio-like mating protein M90

Sequence
7444 bases(100 bases per row)
ttccaccgcgtatttgtcctcaatggggaaattggccttgtacgacgcactactgagtcgcgtggcgcgcgacttggcaataggcgcgaactcctcacgc
tcgagaggcacagagaaagctccgtccacttcgggtggcgcgtagcgggcatcacactgggcctctaagtgggtcgagctcatatccgtgagctcggcat
gggcaagcgccagcactgatagccccaggccgcttagaagcagcgcctgacgcaatgctgatccatgaccctgcagcgaagaaattacagggtgagtttg
gatcaaagattgtgagcttctataaagcctaatttgccagcgagagcgtcattgcgtaggtataagaaaggggaagtaagagatgaagtgtactcgtacc
ttgtggccctgtccgcgcgttaaacgcgccaggtttcgcgctgcaaaaagtcgcatgttcaacacctgcccaacttaacccgatgaagagggcgacaaaa
aggaagacgggtgttatgttacgtcgaaaggcgtaatgaaatgtcgtgttgtcacgttgaagttacggtggttgaagcaaatgctggtaacttgtggtaa
gtgctggatgttccatcataggaatcataggaagtagtttccgaacaaacaaggcggaacaagcgcattctgtatgatgctgctacagtgctgtagctta
tgtgtgttttgttttgtacattgcaaatttctgataggaggacatcattacaagtgaaaggagacattagcaaaacgtttggcactgagagagctgtcca
caatagtggtgtggggtgccggacgtttggtctgacgacaggaaggcacgttgtagctcgaagctacttcatgcgcattgggctcttaatttgtggatgt
aatttcagcaattcgtccatgcgtcgaggcacttaaccgcacgtggcgatgtgggaacgctggatgaagcggtacgacctgataattgggtgcagcgccg
tgctcttcacctgactcataaacagcgtaaactcgagttctgttgtagcaaggtggacagggaacagtggcacaaggcgagcaactcgaaagtactgtac
gagctccgaagatcgtcactcctgaaggtgcgtttcaccttctgtcctgactcaagtcgctcatggggcggaatatagtcgtgaatttcgagaaatacat
gcaatgtcgaccgggaagtgctttctgctttgcaagggaaccctgggttcactccggtggatcgtacgacgcgtgtagaagtgcatgcccctttttccag
tgtgagggattttcacgccctggtcaacgcccggaacagaagtccgtggagttctccgacgagcgttgctacgcaaaaatggaggtcgcgagcgttgggc
ggctcaatcgaaaaataacaactgccacaagccagaaaaatcgcgttgcctccgacgctcgaattgctttcttgcgtttgcggcccaccgactccttctc
gccttgctcgaagaaacatcaaagcgcagtggaaggcgtttcgctcgatcgacacattgcttgggcacaagcggcgccattcgtcaattttgcccaagcc
agacaagtaccaaacactgcacgtgctcagttaactcgcacatactgaagatggcagacgacgctttctttgtgctgcacctcgtggactcggccgactg
ggtcgccgaccacgaacgtaacctttgctacgtctgcaccaggcctttcggcactttccgacgcaaacaccactgccgcatggtgcgctttttcctttgt
ttgtatcaacacagctacgaatagcttttactcacgttggttgtctgtctgctgcagtgcggcgaggttgtttgcaataattgcacgctctacaaggacg
ccaacatagaccccgcgctcgagcctacccgtgtccgcgtgtgcatgtcgtgcgtgatcaacaattcaaaccaacgccgatcaatcgacgcttcaacgcc
acagattagtgcgacgtcggaggcatctcgcgtgtggctgcagaaccacttgcagtcgcctgcatcgggtccttcttctgaaccggacagcgaagagctg
cttcgttctctcacacccaaagcacgccagcacttgcagctcagagacggccacttcaacgctgaaggcgagtctaaaagcagtcgtaagagaaattttc
agcttgagcagcaaagcaacgagccgtcgtctgagtggactcacccatggccccgaccaccagtgagcgttgacgaagcagctcgccttcgagcgttgca
tgcgctaaacatcctcgactccgagtctgagaagcctttcgacatgatctgcgacttggccaaggcgcgtctgtcgtgcccgatggctgcggtgagtttc
ttggacgagcaccgtcagtggttcaaggctactgtggggcttgctcataagatgatcccgcgcaaaatcgctttctgcgcctacgcggtatacacgctcg
agccgatggttgtgcttgacacgcttcaggacgaccgattccagaagaatccgctcgtctcgggtgctgccggtgttcgcttttacgcagcggccccgat
aattgacccaaactcgggacatgccgttggaagtgtcttcgttctggacacacgcccccgggaggcttgcgatatctccattttggaacgactcgcgttg
gctgctgctgaaaatctacctgaaattgaaccgcagaccgataacggggttaacatcgagctggataatattgcgcacgaagtcactgatctggtccaag
ttgccgctcagaacggactcgaaagctttggcagggggaagatcgcggtgccgacgtctccatcgacttcagctacgacttcgtccatgtcgtcagcgca
gtcgtcgctgtcaccacagaaggcagataacagcgacagcgatgagaaccaagaaggcgagtcgatggacatgacacagctttccatggggacaacttcc
gcgggtgagcaaatggaggtgcttctcatgcgtctcttgactcaaaacaccgagacgcagcagcaattggcagtgcagcagatttcgctcaacacgaagt
tgggacagcatacggcgcagatcaaccaactcatggctgatttcgctctaatggaggcaaaagttgaagccaaagttaggtcgaaatgaggagccatgtc
aactccgacgttttctcctcccttgccgtatgctctcaccgttcaaggagatggctctttcaaagtcgtcgcattcacgtgttgtgtaaggatcgctcat
ttactgccggcgagcatgatccaattgctgtcaaatgtcgtaaccggcactatctattcaacgagccctttgattcgcatcccagggtgcttccatgtca
agacatcactgcaaaatgagactacagggtcgctactacactacagactccatcgttttaagcatgaggataacaatgtgatcgtagcgcaaaaaagatg
aaaacacgtggcttccattgatatttttacgaggattttacgaagacgtcatggacgcacagtgtcgatcgtcgtcatttccccctagcatcatgcgctt
gcccgcaacctgaacgagccagcgatagctgaaagctattgggatagcgtgctcccaaacgggagacagctacaaacgcgaattgacggccgggcttcag
gcgtacacggccttctgcttttccacctcggcgatgtaggccttcatggcgtcctccgtggacacgcccttcttggcagtccaagcattccacttagcct
ttcccgtcaggtcgaacatgcccggggcgggggtagtgttgtctcccacggtagcctgcttgtagtacgcgtacagggcgagcttctcgtcgttggtcta
atgatacacaaaaaatcagttaagatctatacagtggtgaacagttggagacggttttaacataccgggttcttggtgaacgtcttggcgagggcggcag
cggcttcgaagtcggtcttgaggtcagacattgcggtgtagtgaagaggaagaagtttgcacacgggaaggaaaaggcaaatgacttaccgatagagttc
ggcggagggatggcatcggtatagacgggtttctaatcctataccaaaaccaagcgaattgacgcctgagttgtggacgagtgacgtggccgaacaggaa
tctcctgtcatctcttccacctttgcaacttgcattgcgaaagtgccagccgatggcttctttcaacggttcacgaatacctttgatagatgaacctttg
ctgccaatactataataaccatgtgccagcagctagctaccagtagcgacatgggtgaataagctgcaagttgcagtctgcccgcatcctccgaaccggt
acttccggtacatgtagtactggaccggtactgcaactcaaattttcgttgcagcagttctaatgctgctgaaaacttgaattgagtcttttaaagtatg
acgtcctctactgtactcaccaccatactttatcccagtattgttttcgagcagtctgctgtccagtcaaaagcgctaaacacaaaaatgcagcgcgatt
gtcactcttggattggtggtgtaccaagcttgaataacatgggaactttccatttcagatctaacaagtgatcaatcgaccgattacgatggtcgacgag
cagccggagttccacgacgtagtcatcatcggcgctggtgttgctggtctgcgctgcgctagccagctgatccacaccaaaggcattaaagacgtggttg
tcctggaggcctccgatcgcataggtggccgcgtgctgaacaacacgagctttatccccgggatgagcattgaggtgggcgccgagttcatgcacggcgc
caacacgacgctcacacgtatggcagaacagcttaacgtcggtcttcgcgagattttcacatgggctcaggtgaggaaacgacacaatgcacgtaattcc
tgtattgtaggacagccgcatcgattaatcagccactgatttgctcgaaagagctttgagataatcttctggccttcatacgaatgcaaaagcgaacgtc
agatcatgtttccttaattagcatctccagggcgagtggcatggcctccctcgggggttttgttgctcttctgcgtgcattcgacggcacagttcttgtg
ttgttgagtcttgtacgtgtccacccgggagaagtcagtctggattcatacattctatacccaaaacaaaatgcatactgaagttaattagggctaagtg
gactgcactccttgttagtcgatactaacacgaaccgattgatttattgcgtatagggagatggtggtccgacagagcctgctccggatggaggcatcgg
ttattactacatcggcgatcagaagcgcatgttgaagtatgacgatgaagatgaggagtttctcaagtttaatctgtctgtggctgacttgagcgacctt
gagaacattgatcagatctcgccccacaaatccatgagggattatttcaatgagatcggattgtcgccatccatgatgaaactatgcgagtccggatacg
caaatacggcaggtgggccactggaggacatttcgatgcgcattacttgccgctatgagaagcagtggatcgagctggaggacgaaggcgactaccgtgt
cgtgccgagcttcatgcgcttcgttgatcacttcgctgagggggtgacgactcgtctaaactggcctgtggctagcgtggattactccgacagcgacaga
atcctggtgaccagcacacacggcaagcagttgtcgtgccgcacattagttgtcactgtctcgacggccgtgttctccaagataacctataccccgaccc
ttccactggaaaagatcgatgccgttgcgtcctttgacatgcgtcgcgctggcaaggtgctgttgcacatgtcaggtcgcttctgggctgagaatgcgca
cggagtcgtatgctcagactgcttcctgcctgagttctggttcaacagcacgaacggaattggtcacctaaagcccaatggcgacacgctgtgcgttgaa
aacgaatctaacaaggttgccgatggcgaaacgcagtacttgatcacgggttttgccggtgcgctgtatgcagaaagcttcgtcggcatcgaccatgaga
aaatcattgagagcttcctcgaccagcttgacatgatatacggtactgtggacgaaccgtccccagcacacaaacatttcgtcaagggaatgtacaagga
cttcggcgacgaaccgtggattggtggtggatatgccttcccacgcgtaggccagtcagattttgcttctcgtgacttagctgcccccatagacaaccgt
attttcttcgcgggagaagccacagcattcgagcagcctggaatgacggtgcatgctgcagtggatactggtactcgtgcatcagcacaggttgcacgtg
cgcttcaagagatgtagatcagaagttgtccgtacacttcacggtttatcgaagcgaagttattgctaacttgtacgcttaatgaagttgttcgaagtac
atgttttcaccgtcagatcaattgcatcccattaatatgggataacttaaacgcaaacgactatcgaatcaaaaaccagttgaacttatttatttgtttt
ggtatcttgcccgtgtatcatacgctcaaactttgtcgtgaaaaaaactcaactcggcgcggatcagcaagtcatcgcaccgcaaaatatttatataggt
agtgtagagggcaggaagcgcagaagcacctcaaggggatgttgtgttgtcccctcccaccttccagcgccgatgctgttatcgcagaagccgtctgctc
aataatagtcgttcgtcaccgcctgctcctcgcgctccagccggctcaaaacgtgctttccgaaggtgaagcgcttcaaatagtcttcgttgtgtcgaat
aatacatacaatgcgatggcggtcgtggtcatccgcgcgctccagcaatttctgcaccacgtagttgccgtacatgtgtttcatcataggtagcagtgca
caggtggttccgctttcgtcataacgaaggatgaagtcaacaatctggctaatttccttcttcgttgcgtgctccaagcaggattccacaacgttgctgg
cgtatttgtgttgactccagcgagcgatctcaggaagcactgcttgcatgacgatgttgcgctggtctggctcgccatgacttataacgtgctgcacgac
gtagttgccaaactggtccttgacaagttcacgacacttgtagataatctcatccaacagcggtcgaattttgttcggggcacagtgctctagtacgcgc
tgaatcacacggcatccgtatgagtgagtggagagggtagcagc