Description :
From Genome Similarity Track
Location :
Scaffold_162:192624- 197799
Sequence
5175 bases(100 bases per row)
GCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGC
GAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGGTCCAGAGGCGGTCAATGCCAGG
CTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCAAAGAGAAGATGAGCGCCGCAACGGCGGGGGCGTCGATGACGCGTGAAGAGTCTA
TGAGACTGAAGCCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGATC
GGCCCTGCTCCACTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTGAC
GCTGCATTTCCCACTTGGGATCAGCTGAAGCAATAGCTCTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGCTACCC
GCCAGGGTAAGAAGAAGTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCGGAACTGGTCAGCGTGGCCGT
GTTCATGGAGGGACTTTGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAGGCGGTGAATGTGGCATTAAATGCCGAG
CACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGGAGAAG
CGGAGCTTCTTGCTGCGGAGCAGCGCGTCGGCGTCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCCCTCTGCGCAAGAAGCG
CGGGGCTCCGGCGAGCCAAACCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGTTCTGTTGTGC
CTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAA
CGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCT
GAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAGCTCTGTCGACCTTGGAGTAAAGTTTGAGAACTTCGA
TAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCGTCCTTGGCATGGCATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAG
TCGAAAACGCTAGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACG
AGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCT
GCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGAT
GACCTACCGCTGCGTGACCCGAGGGTCGCGATCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAATGACACCTAGTTCACTGT
GTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGCGATGG
AGATGTCGCCACACCGCCCTCATCCGGCCGGGCCCGGTCGCGGAGGGAGAGGAGAAAAAGACGCAGGACGTCTGTGACGTCTTCGACGTCGGACGATGTG
TCCAACGTGTCGAGCGGTGATGCTCCACGTGATTGCTGTGAGCAGCTGTATACACTCGTTAACGAAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTG
ACACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGGCAGGCGAACTAGCCGAGGTGGTCTT
GCTGGGACCTGAGGAGGAGCTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATC
CTCAAATATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTTAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGT
GTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGC
GAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCT
TTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGC
TCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGT
GATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGAT
ATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGT
ATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAA
GGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAATTACGCGGAG
ATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCC
AGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGC
CGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTAT
GCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCT
CTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCG
CAGGCCGGACTACGAGCTAGCTCATGTCATGATAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTG
CTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGAACAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGC
TGTACTACAGCACCGACTCGGAGGATAACCCTCGTGTAGTCGTTCCTCATGATAAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCTGT
GGGCGGGCGCTGAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGT
GAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACAGCAGCGCCATTGGCGAGCTTGCTTGTCCCCGAGGGATGCTGGCAGTCCATGAGTATGGACTTTG
TGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTATAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCAT
TGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATGGTCTCGGATCGAGACCCGCGCTTCACCGCG
AAGTTCTATACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCG
TTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAAGGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGC
CTCGACAGGCTACACTACGGTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATA
GCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTA
TGGCTGAAAGCCAAGACACGCAGAAGGAATATGCATATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACCAAGTTTTATTAAACGCTAA
AAAACTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAAACCTCGGTTCATAGGACCGTTTAAGGTCGAGGCCAGGAAGGGCCTAGCGTAT
ACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCT