Description :
From Genome Similarity Track
Location :
Scaffold_48:192616- 194905
Transcript NameFunction/comments
Hyaar_Emoy2806291thioredoxinlike protein putative

Sequence
2289 bases(100 bases per row)
AAACGGCGTGATCTTAATCCTCGTTGAGAAACAGCAAAAAGACATAAGTTTTGATAATCTTACAGGCTCGTAGCCTTAAAAAAGGGTCTCTCACAATGTT
GCGTCTTCGTCCACGTGTCTTGTTCTTCTTTCAGCTATCCTAATAACAGCTGCTTGGCCCGATCTATTAAAAATGGTCTAGACCCACTCTAATAATTGTC
GTGTTGTAAATAAAGTAGTACTTGTCTCTCTGCCATAATAACCATCCGCACTTGGGCTAATGAAGCCAGCTAGGTCTCTTTTTATACCACTCAGAATTGA
CTTAAATGCCAACTTCCCCATTCTCCCGCACCCTTTTTCGTCGCCTGCATATCTAGCCAGCAGCACGCCGCCCCATTCATCTTCCTGCCAGCGTCTCTTC
AAGTCAAATGCAGCTCCTTTTAGCGCTGGCGTCGACACTAGCGCTGCTCACTTCGTTCCCGCGGGTCTCGAGCACCGCAAAGAACCCGAAAGAAAAGGGA
GCGCCGCTCTTTCCAGACGGGCACCCGAATATCACGTTTTTGACCGACAAGAATTGGGACGAGCACATGGCAAAGACGACCAAGCCGTGGCTAGTGGACT
TTTACCACCCTTTGTACGTAAAGGAGGAGTGCATCTTTTTGGCCAATGGGTGACGACGGGGGTATTTTACTGACGGCATTCTGTGATGTGCTTTGTTGTT
TATTTTTCGTGTACTGATATAACGATCCCGGCAGCTGCCCGCACTGCAAAGAGTTTGCACCTCTATTTGTCGAGCTGGCCGCTTATTACAAGGAACAAGG
GTCGTACTATGTGGGTGCCATGAGCTGCATGGACCACGTCAAGTGTCGTCGCGTGGGCATCACGGGCTTCCCAACGCTCATGGCTCTGAATTTCGATGTG
ACGAAACCCAAGATGGAGAACAAGCGGATTGTTGGTACCCACACTGTGCAGGAGGTCAAAGATTACGTCAACAGCGTGGTGGCTGAAGTGGCTTTTAATA
CCACGGGAACTTGGCCACCGGGGTACACGCCTCCGGTAGTAAGCAAGCCCAAGGAGGAAGTGATGACAAAGAATGGATCCAAGGGAGCAAATGAGACATC
AGTGATCACGGAGGCTCCAAAGGTGGTGATTTGGGAAGAATCGACGCTTCCAACAAACCAGACGACGCGTCTCCAGGATGCAGCTTCAGCTTTCGTGTTT
GGACTCAAGCAGGGTGTGTTCATGGGAAGTGATGTCATGGATGAGGAGGAGCTGGACGCTTTGAAAGGCTGGTTGAAATTAGTGTCAACGACCTTTCCTG
GTGCGATCAATCGCAAGGTTATTACGTTGTTGTACGAGCAGTTGAAGGATAAGGAGATGCTGGACTTTGACACGTGGGACGCCATGCTGAAAGCGTGGCA
AGAGGGCTCGGTTGCCGCATTCAAGACAGAGGAAGATCAGCTGGATGTTACGGGGGTCGAGGTCTCTCAATGGCAGAGATTGAATGATTTGTTTCTCGGT
CAAGGAGCAACCTATCGTGCATGCGCACTGTACACATGTGGCCAGTGGAATATGTTTCATATGCTTACGATGAATCCGCCGGAGAGCGGGACACGCAGTG
ACGAGCTCATGGTGTCTGTGGCAGCGTCGATCCGTCGTTTTACGAAGCACTTTTTTGGGTGTGCGGACTGTCGTGAACACTTTTTGAAGGAGAATACTGT
CGAGGTTGTTAAGAAGATTAAGGACGCGGACGACAAGCCACTGGCGCTGCGTCGTTGGCTGTGGGAGCAGCACAACTCTGTCAACAAACGCGTACACCAC
CCCATTTGGCCGAAACAGGAGCTATGTCCGACTTGTGGAACTGAAGGTTCATGGGAGATGGTAGAGGTGGACAAATGGTTGAGTCACACTTACGTTTACC
GTGATGTCGGTGTTCCTCTGGTAGAGAGAGAGGATGATGTTTTGAGAGTATCACTTGTATCTCTGCGTTCCGAAGTCAAAACGGAGACAACGGCCCCTAC
GGATGGTGAGAACAAAACGAGGGAAGCGAGCGCGTTTGAGATGGCGGAGGAGAAGGCTAAGTCGTCATGGCCCACCGTAGCGGAGCCTAAGGGTGGCGAT
GAGTATCGTCCAAAGGATGCAGAGCTCGGTATCAAGAACGCGGCCAATACGAAGGAACTTGTTGCAAACACGAAGACTGAGCATGAGGACGGTTTGCAGG
GCGTCGCAGCTCCTCGCGTGACTCTCTTTGCATGGTACATTCTTCCTGTTGCCGCGGTGGGTGGCTACTTTCTGTTCGTGCGATCCCGT