Description :
From Genome Similarity Track
Location :
Scaffold_77:19251- 25862
Transcript NameFunction/comments
Phyke_g3242hypothetical protein
Phyke_g3243hypothetical protein

Sequence
6611 bases(100 bases per row)
GTGGTGGTGACTTCCTCTCTTGAGCGCCTCTTTCCTCGCCTTCCACGTGCTCTCACGGCCGCCTCTTCGCATTGCCAACTCCAACTCCTGCTCCAGATCG
TTGCTCCTTGCATCGAACCTCTCCAACTCTGTCAAGGCGATCCACTCGAACAATGGCACGATGCTCAGAGCGCTTGGAGCCAACAGCGTCGCCGCCACGT
GTCGAGCGAATCTCACAGCACTCTGTGGAGTTGGGAAGCACTGATACAcgtgcaccaccacagcctcgACACACGTGGCCCCAGTAGGCTGCAGCGAGAC
GCTCACACACGCAAAGCGTTGGCCCGTGGCATGAGGCAAATCCGCAGCACTGAATTGTGCGGTGCTAACGTTATTAACGCCTGGGCCGACGGTGTCACTC
GGGAAGTTCTCCAatgccatcgtcatctcaTCCTCCTTGTAAATGGCAAAGCGACTGCAGTCCTGACCATCCTGCAACCCGGCAGTTTTCTCTACTGCAC
AGACTTGCCGGAACAAATTCAGCGCGTCGTCAATGTTGCGGAATTTGCCGAACACACGGAAGCGAGTGAATTCCATGCGACTTACTtcagtcgcagcagc
agcagctttacGTAGCtggtcaacagcagcttttccagGCTTCACGAGTTTCATGGAGGACAGGGAAAAGGACATGCCCCTGGAAGCAGGACGAGCAGGT
GTCTCTCTCATGAACCCCAGCACGGCAAACGGCTGACACACTCCGTGCACGGGGTCCCAGATCGAagctgcgcttgctgcgGCGCCGGAAGTCGCTCCTG
CAGGTCCGTTCTTAGACGCATTTATAATACTCTCGATTTTGTCCGTGCGAATACGTCCACAATGACGCAAGTCACTACGATATTCCTTCGAGGTTTGGGG
CAACTCTGCCCCTTTGATCGGAGACACAGCAGGCAGTGTCACCGTGAGAGATTTCTTATCGGCAGAGTTACCACCGTCTAAGTTGGATCGGCGATGTGGT
AGTGTATTGACTCCAGTTGCACGTGAAGATGTTTGCGTGGAGGCGCCATTCTCTATGTCCAGCATCGTATTTGCTCGATTGGCCCCATGAATCGACTGAA
GTGTGATCATCTTTGCTGTAGCTTTCCTCTTCAGTACCAGAGGGCCAGAAGCAGATCTGTTCATGTTTGTCTGCAGATTCAACATGTCGCGGGAATCCTG
CGGCAGTGAAGAGTGTCGACTCTTGACGGGGTTCTCGGCTCGATGATCCCggtcttgagcttcttccatcCCCAACGTTGTGTCACGATTGTCGCGAGAT
GTATGCTGGGAACTGGTTGCTTGGTGAATAGGATCTGGACTACCATTTGCATGCCGCAATGCGCCCGAAGTGCCTAGCTTCGCAGCTTGTTTTCGGCGCT
CAAGCATGAAAGATCCAGGATCCACCAGTGTGCGAGGGGCATCACTAACCGGCAGCAGTGGGGCAGATTGAGATTTTGCTAGCACAACATTTTCGTTGAT
AGAAACGGTGCCTTTACCTGAGTGCCCCCCAGCAGACCCAAACAACTGGTGGTGATTTTCAGCCATGACGCCGCTGATGAAGGTTTTCTTGTATTTCTCC
CACGCAACTGATTTGAGTGCACGACTCTGGATGGATTCGCAGATATACCCGTTTGATGAACGCTGCAGACTAGCGCGAGCCTCTGGTGACATCAGGTGGA
AGATGTCAAACCGTGATAACACAAGAATTTTCATCGGAGACTCCGCTAATATCGAGTAGTCGCGGACGAAGATGTCGTTAAACCTCCCTGCCGATGCCCT
GGAGATAGCAAAGCGAGTCAGTGCCAGACAATGGGAGGCCATGCACATGTGATTCTGAATTCGATGCTTACTCTGCGCAGCCTAAGACTGAATTTGGGCC
AAATCTGCCCAGTTCGTACATTTGCCGCTGGCCAGTTATGGGGTGCTTACCCTCGTGAATAATCCGGCACTCTCCTCGAGTtacgatgaagagctccgtT
GCGCGTGATCCCTACAGCAAGACAAGTGCTCAAGTTATTCGTAGTTGTCCAAAGGAGTCAAAGCTTCACAGAGAATTCGCAGTTGACCTGTTTGCAGATT
TCGCTTTTGAAGGGAATGTACTTTTCCGTCATCACGGAGCACATGCCTTCGATAGTGTTGTCGTCCCATTCAGGGCCAATGAAGTACGGATTCTTTCGCA
GCATCTGTGCATACTGTGCGTGATACTCGTTCTGGTACTTTTTGATCAGCGGTTCGTACTCTTCGCGACCTAGTATGAGCAACTCGCAAAATTCGGTGCA
CAACACCGTGGCACGACGAACGCCATCAGCCTGTGATAGCGCTAATTCACCGAAGTAGTCCCCCTCACCGAGTCGTGACACGACATTCtctgttgtttct
tcaaaACGGTTCTTCCCACGAACAGAAACATCGACACAACCGGTGAAAATGATGTAAAAATGCCGCCCTATTTGACCTTCCGCAAAAAGCACGGTATTGG
TGACGCTGCTTATGAGTCGAAGGACCTTGCAGAGTTGCTTGCGGACCTCAAACGAGAAACGGGAGAAGAATTTGACGCTTTTCAGGTACTCCACGGCGAA
TTTAAGGTCCTTCTCGGACCGCTGAGCCGAGCTTCGCATGAAGATATTGCGCACGATATCTTTATTGCTCCGGAACCTCTTCGTTATCTCGAGTGTGTGG
GTACTTGAGTCGTGTGATTCCTTGAGTAGTTCACTGAATACGACGCGATTGATGAAGACCAGCTCTGTCGGGGCACTCGCAACCAACACGGATGCTGATT
CCCACACATCATAAGTAAGTATCCACAAGATAACTACCAAAATCATTCACGACATCTGCACGATAGCCACACCTGCGCGCACATCGTTATTAGAGAGTAG
AGCCCGTTCCCCGAATGTATCTCCAGGCCCAAGGAACACTATATGGACGGTTCCATTGGGGCGAGCGGGGTTGTTGACCTCGTTTTTCACCACTTCCACT
ACGCCCAACAACATCAGATCCATTTAAATTAAAACCCACGGCCAGCACCAGTATTAGTGTTGGATAGCTTACCACGGCCTGAATAGACAAGGTAGAAGCT
GTCGCCATCATCGCCCTTCACGCAGAGATCAAAAAGCGGGTATCGTTGGTGTTGCACAAAACTACTAAAAAAGCACAATGGGGAGACACACCTCGTGGAA
AATGAACTCCCCTTTCTCAGTAAATTGCTTTGTCTCGAGAGATTGATAAAGTCGATCAAGCTGCGGTGACACGAACGGTGATCAGTCACTGCGGTAGCCG
ATGAATATGAACGCAATGCACGGGCTGTGTACCTTAACTGGCAGCGCAGAGAACAACAAACGCGTCAGCTATGGCGTGAGTactcagcagcaatgatTAC
TGTCCACATCCATACGCACAGGCATCGAGGTTGGtgaagaactggagcagTTTGGACGACGCAAAAAGTGACTTGAGCTGAGCATCACATGTTGTAGTGC
ACTGGTGTTAAAGATACTTCCCACAGATTCTGACTCTAAAGAGCCTATTGCTGCCAAGTGACTCACCACATGAATATCCTCCAGAGTGCGTTTCCCAGTG
GGTTTGCGCAGAATGGTGCGGCACAGTTCCACCTGCGGACTCTTCTGCTCAATGGCTCGAAAGAACGCGCCGTCGCTAGccatctcctccatctgcgATG
CCAGAGACCTGCGTCTATTGGCCGGCGAGTCTTCATTGGTCGTAGCTGTAGCAGCATCGCTGTACTCCATGGTGTCACAAGCGTTAGTCTACACTACACG
ACAGTAGCTGCTACCCCGTAGTGCTCTTAAGAGTATTCTCGTACGTACTTGAAGGCGAAAATAAACCGTCACACAATGTGTAGCCATgtaaatgtagcca
tcttgtCATGTCCATCACGTTGCACGATTTACTCTAATTAGTAGTGAATAAATTATTTCATAGTGAATTCTGATAATTCTTATCTACTGAGGGTTCTCTC
TTAACGCGACAAATGATAGACGGCCCAGCATGGGTCGAGGAGACCTTGCGGCGGGTCCGTTCGCACTTCGCCAGCGATCGTTCCGTGTCTCTGTATGAGT
CTCTGACTGCCCATGTGCTAGATGCAACTACTGGCGgcgtgatcttcttgggcGGTGTCTCATTGGCTCAAGTGGCTCAGAAGACACTGCACATTGGCTC
AGCCACTCCTATCTACATTCCGCAGCTCTTTGGggctgcagctgtggcttCTTCATCCATTCTGGCCATGCATTTTGCCTCTGTCCCAAGGGAGGTTTAC
CAGGAATTGGCCATGCATAACCGGCGATCAGCAGAGCAGCGCAACTGGAGTTGGCTGGTGCTGGGCGCGAAGGTTCCGCCCCCAACGGCGTTGAAACAGA
TGCAGGACAAGGTGAAAGAGCGATGGGAAGACCTCCCTCAAGCTCCGTATCCCGTGTATATGACCATGGGTCTACTATgtttcaagctgctggggGGACG
GATGAATGCATTAGCTCCTTCTCCCTTTGCCAACCTTGGGGCCTTCCATCTGAAGAAGGCCTCGCTCCCAGCTACGGCTGATTACGCTACCAACGTTGAA
AGGGGGGTCATCCAAGAATTCGGGCGACTGTATGGGTGCCATACATGCGGAGTGAAACACGGTGTGCGATACCACGCAGACCACATGCCGCCCAAACTGT
AGGCACTTTGACATTAGTTTtggtggttgttgctgtttaCCTAACGTGGTGTGGTTCGGTGCACATCTGATGTATAGGGTGGCGAAGCGCACGGATGAAC
AGTTTGTCAGGAAGCTATTCGGGCGCAAGACGACGTTCCGTTTTTACCCGCAGTGCGAACCATGCTCCAACCAACAGGGGagtgtggtgaagaagtCCAA
GTCCACTCTCAAAATGCACTTGTCTTCATTGCGTACGTATCACTCAACAGGCTTGTGGCTCGTGTTGCTATGCACGGGTGGTCTCTACGTTGGTGGCTCC
AATTTTCATGAAACGTCAGAAGTGACCTCGGCAGTAGACGACACCCCCGAGACTGCATATGGGGTTACGCCCTCGGACTTCTCGCTGCTGATTTCTCTAC
GAGAGCGGGAGCGTAAATTGCATCGTGAGCGAGGTAAACAGAGCGGTTCGAGTCAAATTGCTGCGATTGATAAAGAACTGGAGGCAGTAGCAGAGTGCAA
GACAGCCGTTAAAGCCGACATCAAACGGCAGAAAGCGAATTAGCCAGCAGTGTTAACGAGCATTACAACATGCTAGGTCTCCTGCATTCAACACATGCAA
TTTGATCGGTCAGGAGTTTCGTCTCGGGTTTATTTCCGTTGAGATCGCCACCTGAAAGCCGACGGAAGACTCTTGAATTCACCCTAGCAGGGCGCAGACG
GAGTCATGGCGACTGCCAAGAGAGAAGCGCTGGTCAAGAATTTCCTCGACCAAAGGCATCCGAAAAAACAGAACTCGCGCAAGCCGCATCATCCGCTGCG
AGGGCATCGACATCTCGTTACTCTTTCGGAAGAGGAAATAGCCCGGCGAGAGCAAGGGTGGAATGATCGCTTTTCAGTGGATCCACCACTCAAGTCGAAC
AAGGCATCGTCGCCATTACATTCACCGACAAATAGTACCCCTCCTACCCCGCTGACAACAGAGTCCAAGATACGAAATGAACGCGCGCAATATGGTATGA
TGCAGATTTTATTTGGTCTAGTTTGAGGGGTATCAAGGATTGCCCGTCCTGAATATGCGCAATGTTCTAGGCAAACGTGGCAGGAATCGTAACAGTCATG
AACCGAAAAAGCCATCGAGTGGGAGACTGATGCCTCTGGGTACTCTGTCGAAGCCGCCTACGGTAAGCTTTAGCCTGCATGTCATTTACGGTCCAAACTG
GTGCAGTGAAACTGAATGTTATTGTTTCTATAGGAATCTACGCAGTCGTCGAAGGAAGAGAAACTTCGTTTTAAAGTATTAAAAGCGATTGATGCCCGCG
AGACACAGCTATATCAGCTCAGCGCCCTGATTCTCTGCACACCAGTCCAGGAGTCGCTTTTTCTCCCGTCACGCCCAGCCGAACCACCGACAACGAACCA
TACCGGTCGGCAACAGATGCGCTCGAGAGGAGGAATGGCACTTGCGGCGACCCCATTGAGCCGCCATGGAGGAACAATGACAAATGCGCGTGAAGCGACT
AAACtagcgcagcagctggccACAGATCTTCAAATTACAGGAATTCAGTGTGTGGAGGCATTAGTTGAATGGATGCTGGAGGCTGGAGCGCATGCTGAGT
ATGTATTACTCTCTTCTTGTTTCTGGCGATATTTTTTTTGTAGTGACTAACCCTTTCAATTGCTCTGTTCACAGAACCCCGCCACCATTTCTGTGGCGTG
GCCGAAATTACTTTTTGAAGATGGTTAACGATTTGGATTTTGCAGAAGCGGAGTTGCAGGCACGAGGTATTAACTTGGATTGCTTTAAGCAACGAAACCC
ACTGCTCCTTAAGCCAAACCAAAAGCTTGGTCGTGTTTTGGCTGCGCATTCTATCGTTATGGAAATGGTCGAGTTCGCGAAAGATCTGACCCCGATGGAA
CTGCTTGCACT