Description :
From Genome Similarity Track
Location :
Scaffold_113:1925- 3376
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_113-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1451 bases(100 bases per row)
CGGCGTTCTACACGGCGGACGACTTCAAGGTCTCGTTCGCGCTCTTCTGCTGCGTCTGCGGCATCGGGACGCTCGGTATGCCGGCCAACTTTGCGCGCGC
GGGGCCGTACCTGGCGATCGCGGCGCTGCTCTTCATGGCAGCGTCCAACATCTACGCGACTGTCGCACTTTCCAAGGTGATGCTCGCGGCACCGAAAAGC
GTCAAGACGTACAGCGACCTGGGCGAATGGGTGATGGGGAAGCCCGGGCGGTACCTCGCGCTGGTCGCGCAGATGGGCGTGTGCCTTATGATTCCCTGTG
CGTTCCTCGTGCTCGGTAGCACGCTCTTCGAGGTGCTCTTCCCTGCAGCCTTCAGCCAGATCTACTGGATTGTGTTCATGGCCGTCATGGTCTTCCCCGT
CGCACTCATGCCTACGCTCAAGGAGAGTTCCGGTATGATGTTGGCCGGCTCGCTCGGCACGGTCATCGCGGACGTCATCGGAATCTACGTGCTGCTGCAC
GAAATGAGCGGCCACCCATCGGTACCATCCCCTGACGTGAGTCTCGACCAGGTCATCACGGTGTTCGGCAACCTGGCGCTGGCCTACGGCGCGGCCAACG
TGATCCCAGACCTCCAGCGTGAGCACAGCGAGCCGCACCGCATGCCCCGAGTGATCTTTGTCACGCTCTTCATCATCTCGTGTTTCTTCTTGGCGCTCGC
GGCGCTAGGCTACAGCGCCGCAGGGTGTCAGATGTCAGGCAACATGCTCTTCTCGATCGCTGGGTCGGGTTCGACCGGCAAGTCGACGCTCGGCTTCGTC
GCGAACCGTGGCGCCGTCGTCATGGCGTACCTCTTCATGCAGCTGCACATCACGGTCGCCTTCTCCACGTTCCTCCACCCGACGTTCTACATGCTCGAGC
GCATGGTGCTCGGCATGCACCAGGACGAGATCGTCGAGGGCGAGGAAGGCGACCAGCTGGACAAGCTCTCGTACGTGTCGGCGTCCACCCCGTCGATCTA
CACCAAGTCCGCGACGACCGCTGACCTGGAGAACGCCACCAACGAGCGAAGACTCCTGACGTTCAAGGACACGGACGAACTGGCCGAGTACCGCGGCACC
CGCAACGTGTTTCGCTACGTGCTGCTGCGCACGTGCCTCATCGCGGTGCTCGTGGTGGTGTCTGTGGCGCTCAGGACGCGCTTCCTCGCGCTCGCGGACT
TCATCGGCGCCTCGGCTCACTCCACGAGCTGCCTCATCTTGCCGCTCGTGTTCTACCTCAAGGTCTTCTGGAAGAAGCTCCCGGCCTACGAGCGCGTTCT
TGCGCTGATCATTATCGTCGTGTGCATCCTCTGCGGCGTGTATGTGACCATCCAGACCGGCAAGGAGCTCTTCACCCCGGACAAGGTCACGCCGGAGACG
CCCGTCTTCCCCTTCTGCGCGGCCGAGCACCAGTTCCTCTCGTACTACGTC