Description :
From Genome Similarity Track
Location :
scaffold_413:19248- 22438
Transcript NameFunction/comments
g8139.t1 hypothetical protein PHYSODRAFT_370878
g8140.t1hypothetical protein

Sequence
3190 bases(100 bases per row)
CTTGACCTCTGTTGAGGTTAGGTCTCGTCACAGGGACCGCCTCTACACCGTGTTCCCTAAAAACTAATAATGAAAGGACACGGTACTTACGACTCTTATA
ATTAATGTACCAAAATGTCTGAAATATCGGACACAATGACTGGTAGCGGCAATTCTAGACTATGTTTCTGAATGCCGCATACTATTTTGTTGTTAGCAGC
AGGCTGCTTTCTTGAATATCAATCTTACTTCTCTTTTTACCTTCTTCTATTGTCTTCAAGAACCTACTTCTTTCACCAAGCGCCCGTGCTCCCCGCAACA
GGTTATGAGCCCTCACCAAGCCTCAAGTGACGACTTCCCCCGACTCTCCGGTGCGAGGAATTTCGGCGTGTGGAAGGCCCGAGTAAGTGCGTCGCTCGAT
GGCAAGCACTTGCTCGGTTTCGTCACCAAGAAGGACTACAATGGGGTCAGTGAAGACGAAGATGAAGACTCCGACGACGATCTGGCCGAGTCCGACGACG
ACCGTACCTCCAAGCCAGGCTCTCCTGCTGGCATTGACTCGGACGAGGTGGACTTCGAGGACAGCTAGGATGAGTTACAGCCCAGCAACGACGGCGAAGA
CAGCCCGCCCTCCAAGAAAACGAAGCGGGGTGATCTACCCATCGTTCGTCCCTTCGCTGAACGCAACGCTGGACGCGATCGCAGACAAGTCAAGCGGAAC
AAGCCTATCCTACCGTCTGCGCGCCAACTTCGTCGTATGGAGGCACAAACAAAGGCTTTCCTGATGAAGACGATGGACGACACTCACACCCGCCTTGTCA
AGAACCTGACGACTGCCTTCGATATCTTCCAGGCCATCTGTACCAAGTATAAGGGTGCTGCCTTTCATGGCGACCCTTACTTCATTCAGCATTTCCTAAT
GGAGATCAAGTACGAGGAAGGTGGTGACTTGACCAGCTTCTTCCTTGAGCTGGAAAACGCGATGAAAGCCGCGTCTGAAGCGATCGAGTCTCCCTTGACT
GACGGACAGAAGTCACTGTACCTGTTCCATTCGATGCCGAAGACTTGGAAGGATGACCTTCGAGTTTGGAAAGGCGTGCGGAAGTATATCACGTATGATG
AACTCAAGATGAGCATTGAGACCAAGGTTCGCGAAATCCAGGCTCAAGAACGTTACAGCCTTATCAAAGGGACACCCGAGAGTCATTCCACTCTGGCAGA
ACGGGCTCTCATCGCCCCTTCTCAGGGCTCTGCGTTGGCAGCTCAAGCAACTGTCCCTGTTGATGTCTGTAGCTACTGTCAGAAACTGCGACACAACATT
CTTCAGTGCCGTGCTCTGCAGAAGGACCTACGCGATGGCTGTGTCAAGGCAGGCACTGTCCTTCCCGCGAACTTTGAATTGCGTGGTCCCAATTCCTATC
GATCTCACCCTTACAACAACAACAACAACCAAGGGCGATCTGGACGTGGCAGTGGATCATGGCATCAAGGCGGTCGTGGTGGTCGTGGTGGTGGTGGTGG
TGGTGGCCGTGGCCGAGGTAGTTATGGTGGGAATCGCAACAACAACAACGGCAACGCAAACAACGGAAACAGCAGCAGCAACAACAACAACAACAAGTCT
TTACGTCGCGATGAAGGTGGCTATGACCAGTCATGCCGCAAGGAAATTCTGATTGCTGTTGTGTCAAATGTGCAGACAGCTGCATTCGCCATCAGCCTAA
CGGCTCAGCCCAGCCCGAACCTTGACACCTGCTGGACAATTGATTCCGGCTGTAGCAGCCATGATACTCAACACGCGGAGTGGTTCAAGACGAAGACACT
TGCAAGTGGGGGCATCACCGTGGGCGGAAAATCGCAGGTCCCAATCGAAGCTATTGGTACAGTGGAGCTTCAGATCACCAACTCTAAGAGCCAAGCGCGG
ACCCTAACGCTGCATGATGTCCTGCTGGCTCCGAAACTCCAGTACAACCTGCTCTCAGTTGCTGCCGCTGTTGACGATGACTTCCGTTTTGGTTTGAAGC
GTACAATGTGTACTGTCCAAACCAACCACCGCTTCTCCATCAAGGCGATGAAATCCGCGACGTCGAAGCTCTATCAGTTCGAGGCCACACCGGTTCCAAA
GGCTGAAGCTCACATGACTACTTCAGGTACGCCAACTCGTCTCATGCTTTTACACAAACGCCTTGGTCATCCTAACATCCGTGTTATGCAGGCACTCACT
AAAGACCAAGCTCTTCACGGACTGGATGCACCAGCTGTAGTTAAGCCAGATTCTTTCTTTTGCGCTGCATGTACATACGCGAAGTCACACCGCGCCCCTT
TTCCATCTAATAGACATGTTGAACGCTCTACAAGTCCGTTGCATAAAGTTCACTCTGACATTTGTGGCCCCCTTCCCGTCCCTAGCCTCGGTGGTTGTCG
CTATTTTGTCGTGTTCATAGATGACTTTAGCCGCTACATGTTCACTTACCCGATGAAGGCACGTAGTGAACTATACTCGTGCTACCAAGACTTTCGTATG
AAAGCACTGAATATCTTTCGCAGTGATGTCCATACACTTGAGTATCTCTTGCCACCACCTGATGTGGAAATCCAGGCCTTGCAAGCCGACAATGCAAAAG
AGTACGAAAACCTGGGACGTCTCATTTTTTAGAAATATGGAACGCACGCTCAATTTACCAATGCTTATACACCACAACAGAATGGTGTTGCAGAACGACG
CATGCGCACGATCATGGAACGTGTCCGCGCACTACTGCTAAACGCCTCGCTACCTAAACCACTTTGGGCAGAATGTGATACACATGTTACGACACTCCTG
AACATGACACCGAGCGCTAACACGCAGGATCACACACCGTTTGAGTTGTGGTACAATCGAACGCCATATATTCAATATCTAAACGTTTTCGGTTGTGCTG
CGTATGTCCATATCAACAACATCTACAGAGACAAACTTGATCCCCGAGCCAAACTCTGTATCTACCTGGTCATTCCTGAGCACAAGAAATGATACCGGCT
CATGGATATAACAACGCACAGTGTCGTCTACAGTCGGGATGTGGTCTTCAATGAGATCGATTTTCCTACCGTCGAAAAATTGAGGTGACTTCCGGTCCAC
TCCAGCTGCCAGAACACTTAACGGCACCTCGAACTTCTGCTGATGAACAACCAGCATTTACACCTACTCTCGCCTCTCCTCCTCCAGTCC