Description :
From Genome Similarity Track
Location :
Scaffold_160:19245- 20386
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_160-snap-gene-0.17Conserved oligomeric Golgi complex subunit 8

Sequence
1141 bases(100 bases per row)
GCTCGCAAGCACTCGACGGTAGTGACTGTTTCTGAAGCGACCGCAATCTTCGTTCCTCTCCACCGTGATTTGTAACTTATCCCAGAGTCGATGCTCTGCC
GATCCAAAGCGAATTGTCGATTCTTCTCGTGGACGCACGCACCACAAGACAGCCACCGCGCGAATTCTGGTGGATTTGTGCCCGATCTTTCAGTCCCTGC
TGCGCTGTGGCTCCATTTTTCTTGTCTATGTTTCCGTGACGAGCCCGATTCACCGTTTAGTTCCGTCAAAGTTGCCGCTCGAGCAACCTCGACCGACAAG
CGACCAGATCCAGTTGAAGAGCGTTGCGTCAAACTGATTGCGGCATGAGGCGAGCTCCTCATGGCATCCCGTTGGTCGCCCTCCATCTCTCCCAGGGTGT
CTGAGCCGCCAGGTGCTGGCATGAGCAAGTGGCGTCACGCTGAGCTCTCGCATTTGACGAAACCAGTTGACGTGCATCAAATTAGCGAGTGCATACTGTA
CCGTTGCAATTGGATCAATTATAACATCCACTAATTGGTTGTAAAATGATTCCTCACTTTTCGATAACGAATTATGTGAATAAACGGTGCCGAATAATTG
CGAGTCTCAAGAAGAGTGGGGCGAAAATGGAGGCGGTCCTCAGGTCGTGCTCGCTCGAGGAGCTCAAGAAGGAGCCGTGGCGGCTGCAGATTCAGGCGGA
GAACACAGCCGAGCAGCTGCGCAACCTCGTGCTCAAGAACTACCACGTGTTCATCCAGAGCAACCAGAGCGCCAACATCGTCAAGGACGACGTACGTCAG
TTGGATCCGCAAAGGATCGCTTTTCGTGTCTGACGCTCGTTTGTTTTTTATCTTGCCTATCCTTCCTCTCGGTCGGGTGGTATATGCAGTTGGTGGAGCT
CAAGCACGAGACGAACCGCATCGCCGAGTCGATTCCGGAGCTGCAAGCGTTCTGCGCTGAGTTCCAGAAGGAGGTGGCGGACGTCGTCGCCAAGCACGGC
GACATTCAATTCGTGTTCGACCACTACATCCAGGTCGGGACTCGCCGATCAAGCCGTGGAATTACAAGTCAGAGCACTGACTTGATGTTGCTATTGTTGC
TGTTGTTGCTGCATAGCTGACGGAGCTGTTGGAGATCCCGC