Description :
From Genome Similarity Track
Location :
Scaffold_44:192403- 193678
Transcript NameFunction/comments
Phyra_79920Hypothetical protein

Sequence
1275 bases(100 bases per row)
TCGTCTTGCAACGCCCGTGACACTTCGGCCATCGCCACGCAGGACGAGAGCTTCGTCGCCCAGAAGGCGCGACCGGACATGGCAGCAGCAGGCCGAGAAG
ATTTGTCGCTCCGCTTCCCCTGCTTCACCAGCGCGTAGCAGTCGAGCGACATGAGGTGCGTCTGCAGCTCTTCACGGGATAATCGAGGCACCCAGGCGGT
CTGAGGGAGACCACGAAAGCGCGCCAGCTCCTCGCTGACTTGGTTCATATCGCACTGGTGCGATCGCTTGGTGCCGTCGTTTTCGTTGCTGCCGGGGGCA
AGTGAAGTGATCACGTACAGCAGCAGTTTCGCTTGTCTTGGTAGCTGCTTGATTTGCTGGACAACAGGGGACGAGAGCATTGATGTAGCGCACTGAAACA
CGTCGCGCACCGTAACCTTCACAGGTGCGGCCGAACCCTCCAAAGCTGAACTGCTGACTGCGCCCGAGCGTTGAAGCGCGTGGCGAGCAGATTGCTGCAG
CAAACTGATGGCCAAGCGGGCGTCGCCATCTCGGGCTGCCACCTTCCTGGCAATGAGCTCAACAGCGCGAGGCTCAATGAACCTGGCCACCTCTGAGCTG
TCGGAACTTGACGCTCTCTGCACATAACTCTGCAGAATCAGCAGCAACTCCTGGTGCGAGTAGGAGCCAAAAACCACACGAGGGACCCTCGAGTCGTCAG
AGCCTTCACCGGTAACATGAACGCGGGACACCTGCTCGTACATGTCGACGCCGTTCATGATACCCAAGAACTTGACCTCCGCGGGTGCCACATGGGCCCA
CCGCACCAAGAAATGGAGCAGCTCCTTCACCCTCGGCTGCATCCGCGCAGGAAGCCGCAGCAACTGGTCCACCTCGTCCAGCACCAGCACCACCGAGCGC
TGTTTCGTCTTCACACCGCGCTGCATTGCAACAAAGCTGTCGAGCGCGTACGGGTCCATCACTTCAGGTACACTCCAGCTCGTAGTTTGACGCACCTGCT
GCGCCACGGCAGCGTACAGCGCCGCCGGATCCGTGAACGTGCTGCAGTTGAACCTGACCGCTGTCTTGGCGCCTTTCCTGGTTCGTTTCCGGTTCGTTGG
CGATGCAATTGCCACTGTCTCGTATCCCTGTTCTCTCAGCAGCTCATTCACCGAAGAACTCTTGCCGGTACCGGGGGGTCCGATGATGAACAAACTGCCC
TGTGCGTCTCCCTTGAGCACTTGACGAACAACCTCGTGCTCTTGTGCACGGCCGACAATGGGCGAATCAGCGCGC