Description :
From Genome Similarity Track
Location :
Scaffold_33:192286- 194446
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13493hypothetical protein
Phypa_INRA-310PPTG_13494hypothetical protein
Phypa_INRA-310PPTG_13495inosine-5'-monophosphate dehydrogenase

Sequence
2160 bases(100 bases per row)
GACATTGTCGCATGAATTATTACTCTTGTAAACTACTATTCCACCAACCTTACCTTACAAAAAGTAAGCAGTTCTCCCTTCTCCAGAAGTACTTGCACTT
CCCCTTGCACTGCTAACGTGCTCCTTGCAACGTCAGGGAGCTACATCAATTGGTAAGAAGAGCTAGAAATTCATACATATCGAGTTTTACACGGACCTGG
AACAGTTTCCGTGTCGTCTCGAGCATTTCTTGTAATTTCGCCTGCATGGTATCACCTTCCCCAGTAGTGTTTTCTTCGTCTCCACCATCGAGGTGAGTTC
GCTTAGGTTCTTGTCCGCTCTGGTCAATTTGCCATGCAGTCCGTTGAAGACGAATCAAGCAGAGGCGACACTCTTCCCAACCAACAAACGCATTAGCGTA
GATGTAACAAACTTCCCGACAATCTACTTGTACCTGCGAGGCGGAACACAAGTTGTGGCAGATCCAACGAAGCAAAGTCCGCGTTTTTCGTCCGACCAAT
CGCTAGCAGAAACTAACGCACAATAATCGACGATCAGCACGAAGGTGGTGGTAATGAGCACGAAAGAAAATACTTCATATTTGGTTATCGCCGTCTCTAG
CTCGCGCTGCCTTTCACGAACGCCTGGCTTCAATACGCTAGAACCAGGTCTCAACACTACCATTACGCTGCTAATTGCCTCCGACCCCTCGACTTGTGAA
ACCTCCGGAATTTCAAATATGCACATTAGATTTCATTCCGAATCTTCGTCATGTTATACCGCGCCAAAGCACGACCAACTCTTTTGTTCATTTGGCCTAC
TACTCTATCAGTGAAAATGACTAATAAACGACTACATGTACTGCTTTGCATCGTGCCTTGCTTGAGAGTGGATGTGAGTCTTGTGTGGTTATCTCATGTG
GAGGAGGAGGATGCACGTCGTCTCTCATAATCTGGGTCATCTGTGGGCAGCTCGAATCGGCAAAGTGGGCACGAGTTGTGCTGCTTCAGCCAGGGAAGGA
TACAGTCTGGGTGGAATGAGTGCTCGCACGGTAGACGATGGACCTCATCATCCACAGCGAAGAAATCCTTGCACACAGGGCACTCAGCACTGCCGTCCAC
TTCAACTTGAGTGATCTTCACCTTCGGTAGCTTTTCTACGACCTCCTTAGCTGCAGGAGGAGCCCCATGCTGGTAATTTAGCGGTACAGCATCAAGTTAG
ACATCACACCAGCCAAACCTGTAAGCCTTCCAATATCTTACCCGATTGGGGTCATTCTGCATGAGTTGGTTAATCACATTAGCCATATTGCCAAACGCAT
AGTCACCAGGATTGCCGGCCAGCATTGGAAACATGCCTCCCAAAGCATCCAAAATGCCCATCGGATCTCCTCCACCTTCTCCTGACTCACTAACGTAAAA
CTCCACGGGGTTTCCAGTGCTGCTCATGAAGCGTGTATTCCGTCCAGTAGAACCCGATAAAAACTGGAACAAACTACTCAGAAAATGAACATATGAGAAC
AACCTTTCCTATACACAAAACCTCAAAGAACTCACTCAGGCAGCGGAGCTCCTTCTCGCCCTTCATCTGACGTTGTAAACCTGGCGGCTCGAACTGTTGG
TCTATTCAAAACAAAACGACAAAAATGATAAAACGTAAAAACTATTTAAAAGAAATCATGATAAAACTTGCAAATCGTACCGTGGCAACGGGCGAGTACC
GCCAAACTCATTACGGATTTCCGCCCGCGTCGTGTCTTCCGCAGAGACTGTCGGTGGTTGAGTTTGTGTATGTATGTTTTCTACTTGTTCAGCCTGAAAA
TCCTGTGGCGGATCGTCCTACAAGAAAGAAGAATGACAACAGAATGTAAAAAAGGTTACAAAAAGCGGAATTTACGATGAAAACACACTGTAGACGCACT
TCCTCGATCTCCTCCACAAAGTTGCCGCCGCACTGGACACAGCAGACCTCCTCGCTGGCGTCGTCCACGCGCGTATTTACGGCAGCGCCGCACTCGTGGC
ACCAGAAGCGCGAAGGCTCCTGTTCTGCTGACGTCGGCGACATGGTCAATCTGCGACTGACTTGAATGCAAATGACGCAATTTCATTGGTACAAAAACAA
ATGCATCGAGTATGGGACCAGAGGAAGTTAAATATGGGACGAAATGACTTGCCACTTCAA