Description :
From Genome Similarity Track
Location :
Scaffold_2:1922734- 1930518
Transcript NameFunction/comments
Physo_263366Eukaryotic/viral aspartic protease, active site

Sequence
7784 bases(100 bases per row)
CACAAGTGGTCTTCGCCTTCGCAATACCGGGCACGGGATATACTTTGGCCCACCCGACGCTACGCGAGTCGACTTACACCCCAAGATCAAGGAACCTCGG
ACGACAGGATAGCTTGGCCCAGCGTCCGTCAACCCTCACTTCGACCCACCGCTACAGGAAGCGGCAAGCAAGGAAAGGAAAGGAAGGTCACTCACCGACC
ACAAGGCAACCCCAGGCCAAGATCACACCTGGCCGGCGAGTGTCGATCTAGACAACCCCAGATCGAAACCGCCACAACTACTCCGGCACAGCGTGAAGCA
TATCCGCGTTGCTGCCACAAGTTCCCGCTGTCCACCAGACAGTCCAAGACTCAACCTTCTCGAGATCACCCGAAGAGCGATCCAGCCCACCAACGGGTAC
ACAAGGTGCGGATCAGCGACTTCACGGAAGATCGGAGTACCCCCTCCGTTAGTCGGCAGTTCGGGCGCCGTGTGCAAGAGGGCCCCCGCGATCTGCAAAT
TTCGCGGATCCACTTCGCCACAATGGTGCGCGTGCCCGGATCTTTGAGTGACTCGGGATTTCACCGTGAGTCCCTACAAGCGGATGCGCAAGCCGAGTTT
GGACAAGGGAATGAAACGTCGACAGAGATCGGATCGCCATCGACGCCGCTGAAACATAATCGATCCGCGGATCGGCAGAGCCTAGGGAGGAGCTCTACCG
ACGGAACAGAGGAAGGTCCGGCGACGGACCTAGAAGAAAAACCTCAACCTCCTCCCCAGGTCCCCTCGGGGACCCCCGCAGGGCACGATGCGAATCGTGA
CCTGCCGGACGAAAGTCCACCGGTGCAAGCCGGAACCCAACCACCCAACGCTAGATCGACCAAGAAGAAGCCAGCAGGATCGAAGTCGTCGGAAGAAGAT
GAAGGCTCCAGACTCCGATGCTGACGATCGAGCCGATCTCACGACCGTGGTTGAGGACCAACTGGCTGTAACGTACTACAAGAAAGAGCTGAACGCTTTC
CTGCTTCAGGACAACGTGATGAAGCTCCTCCGGCCGAAGCTCCTCGGCGATCTTGCGGGACCGGTGTCACAGCCGACCCCTGGATCGGACAAGTTGGATG
CCGTACAGACCCTGCTATGGCTCTTCAAAGTTGGCATCATCGCAGGAGCGCTGGATGCGGAAAGCCTGTTCAATCTGAAGCCCAACACGATCCAGAACTC
GACCCAGAGGCTGTTCCTGTTACTGAAGCCGTTGGTCGGTGAATCGAGTCGATCCTTGAAAGAAACATCAAGATCGCCTCAGACGCTATCGAGATCGACT
CCCGCCAGATCGACGCCTGCGCGCAACCCGGGTGACCAAACTCCGACGTCATCTCCGTACGTGTCTGCAACGGAAGACGTGGACTCCGATAGTGTCGATG
ATCCGCCGCCACGTATGACGCTTGGTCCTTCCGGTGCCGCCATGCTACGAAGTCGAACCGAGCGTGCTGGGGGCGAGGCCGCGGTGCCAAGGCGAGAGCC
GAAGGCCACAGCAACCTCGACGCGACACTCACCGGAAAAACTCGAGTCATTCTTCCAAGCGGCCATGGAACGTTTTCTGAAGGAGCAGCAGCTACCTGCT
ATCGCGTTGAAGTCGCGACCGACCGGTGATCAAGATGTGGAGATGGGGTCGGTTGGATCACCAAACCGATACTCTACGTCATGGGAGTTCGATCCTGACG
ACCTCGATCTTGGTCGACCCGTCCGCACAGCGATCGCAGCGACAGCTACGGCTTCGCCAGGAGGAATTGAGTCTGCACCACGCATTCGTGTTTCTGCAAT
GTCGGAACTGAAGGAGTTTTCCGGAAAGGACGGCGACGAAGATCGAGCTCGAGCTTGGGTCAGCAAGGTAAGATTGGCCTTCGTCCGCGATCAAGCACCT
GATGATGAGAAGTGTCTGGTGTTCGGCGACTTGCTCACTGGTCCAGCGAGAAACTGGTGTAGACAGCTGAGCCGAACAACTCGCACCACGTGGAAGGACC
TGCTCCAGAGTTTCCAGCTCCAGTATTGTGGTCGTGGTGTCTCGGTTGCCCGCCAGTACTACCATGCTCGGAAGCGATCTGACGAGTCGCCTCTGGAGTA
CCTCCACAGGCTCAACGTCGCAGACCTGCGGACACGTCTACAAGTCAAGGACGGTCCGCCTGACGTGCACCGGGAACATGTGGAGCATTTCATCGAGACG
TTGGACGACCGCGATCTAGCGGACCAGTTCGCCTTGCTGCGGATTCCTGATGCGGATACCCTGGAAGAAGTTCTGCGATCTCGCCAGCGTGCCAAGGCGC
GGCAGAGCAAGACAGTGTATGGCTCGATCAAGCCCCGTCCGAAGCCACCAGCTACCGCCGGTACCCGCGCAGTGCGAGCGATCCAGATACCGAGTGACAC
TAGTGACGCCGACTCTGGATCAAGTGGATCGGATGAAGATGGAGATCTGCGCCGAGTGTACGCGACCGCGGCTGGCAACAGCAACGGAGCGACTGAACAT
CGTATCTCTGGTCAAGACCGGCGTCTACCAGAACAAGGTCGCAACCGTCAGGATCGTCGGCCCGGACAACACTTGAAGCCAAACGACATGGGAGCGCCCC
TCAAGCGGTGTACTCTGTCAAGCATGATGATCTGGGATGTTGGAAGCGGCTGACGTGCGAGAAATGCGGCAAGCGTGGTCACCCGTCGGATCGCTGCCTC
TTTGTCTGCAAAGCCTGTGGCGAAATTCACGACGAAGGGAGCTGTCCGATGGAGGAGTTCTACAATTTGATCTGCCAGTGGTACAATTCCACCAAGCACG
GGGGCATGTTGCCCGAGTCCGCGGAGAAGATGTTAAACTAGGACGCCCGCCGGGTTGGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTTTGCG
TATAGTCACAGTCGACTGTAAGCAAACTCATCGACAATACATGTGATCTTCAAAAGAAAACTACGGCTGCCGTGTCAAGCCTTCACCAAGTTGATGACTA
CTCAAGATCGAGTGCGAAGATGGCCTTGGATATCGCGTTGGGGGAGTCGCGTGGTTACTGGAAATACCATGTGCCCGACAAGAAGTTCAAGCAAGCGAAA
GCTCTGGGCAAGATCAACAACGAAAAAGCAACTCTGTTGTTTGACAGTGGTGCCGAAGTGTCTATCCTAGACACCGCCTTTGCTCGTAAGATGGGGTGCT
ACATTGATGAAAGTCAGACATTGGAGTGCGAAGGCGTTGGAAAATCTCCATACATGGCGGAAGGACGTGCGCGGGTCAAGATCACGCTCGCGGGATCGCT
TGTGTACTTCTTCGATGTCTGGGTGGGGCCGCCGACCGGCGGCCAAGACTTGATCCTCGGCATGGACTTCATGGTGCCGGCCGGGATCCGCCTTGATCTT
GCCGACGGAACCATCTTCCTGCCGGACGAGGTGCGAATTCAGCTTGCTGGAAGACGCCCGCTCTACGGTGACAAGGTCGAGCAAGTGAACTTGGCCGACT
ATTGCGATATCGACGTGGCCGGATCAACCGAGGTGAAGCTGCGCACGAGACCAACAGAGCATCAGAAGCTTTGGGTCACACGTGGCGATCGATGGGTGCC
TACCGTGACTGCAGGCCCGGGCAGGGCTCGTTACCTGCAACTGACAAACGTCAGCGAACGCAAGTTAGCGTTGCATCAAGGTATGCGACTCGTGATGTGG
CTGTCCGGAGATCGAGTGCTGCGCTTACCTGGGTATATCTTCGTCGGATCTCGCCGCTACGCTGAGTGGCAGAACTTGGCGTACCAACCAACCACCGACA
CTGCGGACGATGTGCCTGAACCTGCCGGTGTGGAAGAGCCTGCTGTGGAGCGGCCTCAGTATACGACGCCGACCGCGATCTTGGCCCGCCCTGCAAAGCG
ACCGGAGGTGGCCACAGTGTGTGCCGAGTACATGTCGCCCAAGAACCCCGACGACTCCAACCCAGAAGGGTCGTGCGACGACCCCACCAAGTCTCACGCG
ATGCCCAGCAGCGACGAGGAACCGAAGAACATCGACGAATTGCGCGCAGAAGAAACGCGCCATGATTTCGCCACGTCGCTGGGGGCGGAGAGACCATCGG
GTGATTATGACGCTGAAAATCCAGTCTGCGACACGGAATGTTTGGAAGATCATGCTCCGTCGGTGCGACAGGGGACGTCTAACCGCGATCGAGTGGTTGC
GACGGACGCAAATCAGGCGTCTCATCAAGATTACGGTGGTGCGACAGGCGCAAATCAGGCGTCAAATCAAGATCGGCGGAGCGAAACGGATGGGCCCAGC
GACTTCCAGTGATGTTGGAGCGACGCGTAAACCCGCACCCATGAGTGATCTTGAAGTTGACGCGCGCCCAAGACCGGTCGAATCAGATGATCCTGAGGTA
TGCATGACGGAAAGTGGCGATCTCTACGCGGAAGACGTGGAAGGTCAAATGGCAGTGCTCCCGGAGTTCTCTACGACCGATGAAGTTGTGATCACGGACA
TCCAAGTGGGCGATCTTGGCGAAAACACGCCGGAGGAAATGGACCGACTGCGGAGGATCATCTGGCGTCGGAAGCATCTACTCATGGGAAAGGGAAATGC
CTTACCAGCTGCCGCAAAAGTTGCGATCTGCGACATTGACGTTGGAAATGCGAAGCCAGTCGCTCAGCGTTGCCGTAAAGTGGCGCCGCAGTACCGCGAG
AAGCTGGCGCAGCTAATCAAGGGACTCCTGTCAGCCAAGATGATCAAGATTTCAACGTCTCCTTGGGCATCACCGATCGTGGTGATCGTCATAAAGAACG
GAGTCGACATCAGACTCTGTATTGACTACCGTCTGGTCAACAGTCTGACGCGTATAATGGTCTACCCGATGCTGCTGATCGACAATCTCCTCGAGGATCT
CGACAAGGTGCTCTGGTATTGCTCGCTGGATATCGCTAGCGGTTTCTGGGTGGTGACGATGACAGATCGAACTCGTGCGATCTCCGCGTTCATCACTCCA
TGGGGACTCTACGAGTGGAATCGAAGGCCATTCGGATTGAAGAACGCGCCGCAGATCTATCAGCGGTTGATCGACAACGCACTCTACGGCTTCCTCAAGA
TCACGGACAACCAAAATCGACAGGGACAGATCGACCTTTTCAAGGACGGAGAATCAAACGTCGAGCAAAAGACCTCTGTCCTGGGGCGTCGATCTTATAT
CGATGACATCCTGGTCACGGCCGGTTCGTGTGATACGCTGTGTGAGAAAGTGGAGAAGCTGCTAGATGTCTGCGAGGAATGAAACTTGTCGATCAGCGTG
GCCAAGAGTTTTTGGGGATTGATGAAGGTCGACAATTTGGGACATCGAGTGTCTGCGGAAGGTCTAGAGGCTCACCCGAAGGATCTATCAGCGTTTGCTA
ATCTGCCGTTTCCGACCACCCTGAGATCGATGCAGTCGTTCTTGGGTAGTCTCAACTACTACAGCAGGTTCATTGATGACTTTGCGGTCTACGCTTCCGT
GCGGTATGAGCTCCGGGAGGCTGACTTCTACGAAATCACCCGACAGCAGTCCAAGATCGGTGTTGCTCAAGGAAGAGTCGAACCGGATCAAGATCAACCG
GGCCAGGACAAGTGGGGCCGGGCCATCACGGCGTTTACAGTGTTGAAGGACAAGATCGTCAAGGCGCCGATCCTGCAGCATTTTGACCCAGACCGAGAAC
CAGTCGTCGTAGTGTACGCCAGTAAGTGGGCAATTTCCGCGGCGTTGATGCAGGAACACGACGGAGTGTACAAGCCAGTGACCTTTACCAGCCGGACGCT
CAAGCCGAACGAGATCAACTATGGAATGGTGGATAAGGAGGTGTTGGCACAGCTCCTGATATTGGATGTCTGCTACACGCAACTGGTTACCAGATCGATC
AAGGTCCTGACCCGATACTCAACGTTGGTTTGGCTGGTGCACTCATCCGGCCTGCAAAGGCGCCTTGGCCGTTGGCCAGTGTTACTGTCGTCGTGGACAC
TGGAGATCGTGAAGTGCACGAAGGGAGAAAATGAGATCTTGGGTGTGATAGCTGCGAGCATAACGCTACGCGAAGAAGTCGACGCCATGCTGACGTCGAT
CTCCCCCAGGAAACAACCGCGACAAACGATCACGATGCCGCCGCCCGCTGTAGAGATTGGTGAAGAACTGCTGGTGGTTAGCTTCGACGGATCAGCTCGT
GTGAAACGAAGTGGGGGTGCCTACAGCGCGATTGTGTAGGGATTGCCGGAATGGAAGGTGATCTCGGCCGCCTCGGAGTACTAGGTTGATCTTACGGTGA
ATGAGGCGGAGTATCACGGCTTGCTGCTTTGTTTCGATCTCCTGGCTAACCTGGACAGAGGGCGCCGCCTGATCATCTGTGGTGACTCCAACTTGGTGAT
CCGTCAGATGCGTGGAGAGATCGAGTGCAAGGCCCGAGTTTGGTACTACCACGTCAGAAGGCCATGGAACAGTTGCGATCTTGGCCTAACCACGAATTTC
TCCACATGAAACGTGACTGGAACCAGAGTGCAGATCGACTTGCAAGCGCAGCACTACAACGGGAAGGTGACTCCATCGTTACAACAAACGAAGAACGCGA
AGATCTGGGGACGCTCAACCGCCTCGACGAACGATTGGTTCCTCGATCTGACGCGGCAGTGATCAAGATCGCGGCGGTTACGACGAGCGGCCTCACAAGT
GTTGGATGAGTTGATGGTACAACGAATGCGGACGGAGCGCATTTGCCAGGCCCAGGATGAAGAGAAGCGGATTGCCGATCTCAAGAAGTATCTACTTGGG
GACGTGCAGGACCTTACCTCGGCGGAGGCTAAAGCGTGTGCCAAGATTGCCGATGACTACGAGGTCGACGAAGCTGGATTGCTGTTCTACTGCCCGCCAT
CGAAGCGCTCTGATGAAGGTCGTCATCTTGTGATGCGGCTGGTGATCCCGGAGACCTTGCAGCAGGACTTCCTACACCATTATCATGCCAGTCTCGAGGG
TGGCCACCAAGGCATTGGAAGAACCTACCAGCGGATTCGTGCCCATTTTCACTGGAGAGGCCTCTACCAAAGTGTACAACGATACGTGGGGCTGTGCGTG
GACTGCGAAACCGGGAAAGGGAGGCCGACTACACAAGGAGAATCTCCCGGTAATCTTCAGGCTACCTACCCGTTCCAGATTATTGCCATGGACCACATCC
CGTCATTACCCAAGTCGTACAAAGGGAACACCGAGTTGTTGATCTGGATCGATCTTTTCACGGGATTCGTGATTGCAAAGGTCAGCTCGTCTAGAACAGC
CCAAACGATCACTAAGAACTACGAGGAGTGCGTGTGTCGCCGATTTGGCGCTAGCGAAGCGATACGACATGACCGCGAGCCAGGAGTTATGTCGGATTTC
TTCAGATCATTCAACAAGATCGTCGGTCAGAGGCAACGTGCGACTATGGCTTATCGGCCTCAGGCCAATGGTACCGCTGCGCGGATGGTGCAGACGCTCA
CTCGCGCTCTGAAGATGTATGTCGAAGACATCAACCAGCGAGATTGGGAAGAGTACGCGGAGCGCCTTACTTTTGCGCTCAACACGGCCCAAGATCGAAT
TCGGGGAGAGTACATGAGTGGGACCCTCGATCTACTCTGGAGGCAATGGTACCGCTGGGATCGACGCGCCGGCGGGATCGACAGCCTCGCAGGTGGCGCT
ATCATGTCCAGAAGCAATATCAGCAGGCCCGGAAGCAAGTCAATGAGTGCCTACGTGAGGCAATTCGAGATCGAGCTGACCAGC