Description :
From Genome Similarity Track
Location :
Scaffold_656:19227- 24086
Transcript NameFunction/comments
Phypl_g10112hypothetical protein
Phypl_g10113conserved hypothetical protein

Sequence
4859 bases(100 bases per row)
AGCAGCAGACGCCATGGTAGAGTACATGTATCCGACTGGCGAGTATCAGGCTGGAATCAGATGAAGTGCAGCCACCATCATCAACTCGCAGTTGGAGATT
TCCTTTGACGAGGCCATGGGATCCGCAGCGGAGACTCGCGCGGGCATCCGCGTGTGCGCTCGCTTCCGCCCGCAgaacaagctggagcagaagcacgAGG
CCGTACAGTGCGTGCACCTGGAAgacaacgccgccgcccacgtgCACTGCGAGGCTCGCGGCGTGTCGGACGATCACACGTTTACCTTCGATCAAGTCTT
CGGGACTAAGTCCTCGCAGCTGGACGTGTACGAGGCGACGGCCAAGCCGCTGGTGGAGTCCGCTCTGCGCGGCTACAATTGCACATGCTTCGTGTACGGC
CAGACGGGCTCGGGCAAGACTTTCTCCATGGAGGGCGTGCCAGGCGACAAGGACTATGAGGGCATCATCCCGCGCGTTATGGCCGACATTTTCGACGGCA
TCCAGAACATGCAGGCAGACCTCGAGTTCATCGTGCGCGTCTCGTACCTTGAGATCTACATGGAGAAAATCCGTGACCTGCTCAAACCCTCGTCAACGAA
CTTGAACGTGCGCGAAAGTcgcgagcgcggcgtgtGGATTGCCGGTGCTACGGAGGTTTGTTGCGCGTCCGCGGAGGATATGCAGTCCGTGATGCGACTG
GGAGGTGCGAACCGAGTAATTTCGTCGACAAGAATGAACAGCGAATCCAGTCGAAGCCACTCCGTATTCATCATCACTATCGAGCAGCGGAACACGGCGA
CAGGATCGATGAAGAGCGGAAAGCTGTTCCTGGTGGACTTGGCAGGATCGGAGAAAGTGGGGAAGACCCATGCTCAGGGGCAGACGCTGAAGGAAGCGCA
ACACATTAACAAGTCGCTCAGTGCATTGGGCAGTGTGATGAACGCACTTACGAGCGGGCATGCCAACACGCACATTCCGTACCGTAACTCCAAGCTAACG
CGGCTGTTGCAAGACTCCCTTGGTGGCAACTCCGAGACCACTCTTCTGGTGTGCGCTagctccagcagctacaaCAGCGAAGAGACGATCTCCACCCTAC
GGTTCGGTACTCGGGCGAAGAATATTAAGAACAAGCCTAAGATCAACGAAGAACGAACGGTGGAAGAGTACAAGATACTTGTAGCTGAAAAGGACAAGCG
CATTGCATCGTTGGAGGCTCTTCTCCGTGAAGCTAAAATCAATGACGCGAGTGAGACAGTGGATTCTGGAGCAGAGGACAAGCTGACAATATTTGCGAGG
AAGGTGGAGGAACTTGAAGACGACCAGGCATCCAAGGCAGCAGAAATCTCCAGCCTGGAAGACCGATGTATGGAATTGGAAGCGAAAAACAAACATCTCG
AGGAAAAGGAACGAGAGGTTTCATTAATTGTTAGCCAAAACGAGGACTTtgcgaagaagctggcaTTCCTGGAAACTGAGCTCGAAGCAAAGGCAAAAGA
ATGCGAAGAGCTGAATCAAATGCTAACGAGACGTCAAAAACAGGCCACCGCGGTTGTCTCTACCGTCCTAGAGACAGCTCCGTTATCATCAGCTAGTACG
GCCGACAGCGAGGTGTCTGTGCAGGCGACGATCGATGAAAACTGTGACCTGGATCCTGAAAAGCTGGGTCACGCTGAAGTGACTGGATCGTCGGTGCCAG
TGGTGGAGCGTTCGCGTGCTAGTAGTTCGGTACTAGAAaacgagctgctccgccagcagctaGCTGCAAAGGCTCATGAGCTGAAGATTTGCACGTTGCG
TGTTGATGAACTAACAAGCGAGCTGACTAAACGCCGCAGTGAATATGACGACCAGATAGAGGCGCTCCGAGTTAGACTGCGCGAGTACGATGTTCATGTT
CGTGAGCTGGAAGATCAAGGGCCGCAATTGGATTCACTGGTTACGAAATCGAAGATGTTGCGCTCCGTTCGTGGTGGTAGTCAACCTACCCCGTTGGTTG
GTCGATCGAATTTCCAGGACATGAGGTCTGATGCACAGCTTCAAGACAGTACCAGATCAGGCAAGTCGCACAACGAGTGGAAGGTGGATGATGAGATATT
CCCTGTTGCGCCGATCGATATGGAGTCTGAGGTTGTCAAGCGCTTGATTCGGAATATGCCCGAGCGAGGTCGAGAGAAGATATCAAAGTGGTTGGGCTTC
GTGCTCGAAGGACGAGACATTCGCTCAAACTTCCATCCGGAGATCGCAATTGAAGGAATCAACGAGGAGATCAATCGGGATATGAGGCGATTGATCGTTC
CATTGCTGAAGAACCGCCGCGACTTAAAGGTTCAGTCCTATGTCCGCACACGTTATGTTTGCGTCTCGGACTTGAAAATCACGCTTGATCATAAGCACAA
GGACGAAGTGCGGCTTGAACCCATGGGTGCTGCCTCTGCTAGTGACAGTGGAATAACTGAAGGCACCTCTGCAGCCCGCAATTCAGAACTGGCGTGGGCT
AAAGACCACCTATTCTACGGTCCTAAGAGCGACGCCTCCAGTCCGTCAGTGCTTCACGCAAGCCGAGTGCTGGTTCCGTCTAAAGATCGGTTTACATCGG
AGCCTGTGGACCTAAGCGCTAGTGTCACTGAGTCGAAGTCCATGCTGGAGGCACCCCGCAGCGCCCCGCAGCTAAGTCGACAGCCATCGCTTCCGTTCAA
TGCTCCCTCATCCAGTCCAAGCAGCGGTGGGGTATTTAGTCGTCTGCGTTCGAAGACTGGAGTAGGGGCCATGCTTGGCGATGTCAAGACGCGTCTCAAT
GCCCGCTACCACAAGAACCACATCCATGAAAATGCTCTGTGCGATGGTTGCGGTATGAGCCCCATTGTTGGTGGCAAGTGGAAGTGTAACACCTGCGATA
ACTACGACCTGTGTGATAGTTGCTACACCGCGGGCGTTCACGGCTTCGAGGTCAGCAACGAGCTCTGTCGCCGCGTGGAGCAACTCGCAGTGCAGAAGCA
TCGCCTGCTTGGCGAGTACCCGGAACTCTTTGAGCTGTTCCGTCGCCATATCTGCCACGACAACGTCATCCAGTTCCGGCGCGTGGTGGAATGGCTCTGC
GCAGTTGTATCGGGAGCACGCTCGCAAAAGATCTACCATAAAATGATCGTGAAAAGTGGACTCCACCCCGACATTCGAGCACggctcgtggcgcagctcg
gcgcgctgGCTAGCAATCGCACCGACATCTCGTTGAAGACCGAGTGGTTTGCAGAGAAGACGCctgaggaagaagccgccgagTCGGACGACAGTGAAGG
ATCCGATCAGATGGAGCCCGCGCCTGTGGAGCTGGATGGGGACAAGCTGTCGCCGACGAATACCATCTCACCACTCAACGTACGATTGGAGACGCTGCGG
ATGTATCTGACGGACGCGTCGAGCTTAACGCAAGGCAATGAGGCTGGAGCGCTAGATACACTCTCGGACTTGCTGGATCCGTCGGCCAAAGTGGAggccg
acgctgcagcgcagcagccgggCTTGCGACGAACCGTGAGCGCCACAGAGGCGCCTGGAGACGGCGACCACGAGCGAGTGGGCCAGTTGCCAGAGATGCG
GCGTCAGCAATCACTGGACCTGCCGATCTATGGCCGCCAGCGGGTCAAGTCGGTCACGCGGCTGAACATGTAAGGTTTGGAGCCCTCGAATTTAGCTTTA
ACGATGAATGTAGTGCATGCGTGAGTGAATGGAGTTCCTAGTGTTCGTTATCGATTCCTTGTCCACACATCAATCGACAAATGCGCGAAGAAATGCTGCC
AAATGTGACGGGTCAAATGCCCTCACATTTGAGCTACCACCAGCATGTTGCTCCATTGCCCTCGGAGGAACACCATGGCAAGCGCTTCTCCCTCCGAGGA
ATGCGTCACTTCATGACTCACGGGCTCTGCAACGTCTGCTTGGATGCATGCATCACTTCCAATCATCCGCTCGGATCACTGAATTCTTTCTGCTTCGTCT
TTCGGCACTCTAAAGCGCATGCGAAAGCAGGGTGCCCAGGAGTCGTGGACCAGGACTGCGATCGAGTCACACACACCGCTCGTGACAGCCAGCACGAGTT
CGCGCTTGGCATTCCTACACGGCTCCTACTGCTACTGCAACGAGCTACACCCTCCACGACACGTAATAGAGAAGCTGATACATTAACCGGCAACCTGCCT
TCCTAGCTCGTATCCCGTTTTATTCCTCCGAGATGCAGAGCAAATGCCGACGATGACGTAGAGAGAGGGGTTGAAGACAACACAACGGACGGACGCGCCG
CGCAGTGGAACTTACAGCGGCAAGAGCAGGCAAGACAGACGGTCGGCGGACTGGATGTGCAACGTGCTTAGGGACTGGCCTTGCTGCACTCAGCCACGAa
ttcgcgctgctgcgtggagAGGCCCCACACAGGCGCGCCCCGGATGAGCAGCCGCTGGatgagcgtctcctcctcgctggcGATCCGCGCGAGCGCCTTC
TTGTGCTCCTCGGAGGCGAGCGAGGTCTTCTGCGCCTCCCACTGCttcatgagctgctgcagcttggtcagGTCCTGCggctcggcgcgcgcgccggGGC
TGAACTTGGAGCCGGCCTCCGAGCGCGTCTTGGCAGAGCCATAGAAGCCGCCCTGGCCCTCGGAGGGCTGGCCGCCCGAGTACGTCGTGAGCGTGCGCGC
GGAGTGCACGCGgccggcggaggcggcgcggcggcaggTCTTGAGAACGGCGGAGTGCATGGCGTTGggggcttgggcttgggaCGGAGCTTcacggacg
cggcggcgaaTGCGCAAATGCCAAAGCGCCGAGGGGCGACGTAGTGCCGCGCAAGATTC